\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403224975:

Variant ID: vg0403224975 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 3224975
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, G: 0.19, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


TATCGAAGCTACGAGCCGCATTGCACGAGTAGAGCGTCCTCCTGCAAATGTTCCAGGGGAGAGTGCAAAGAACAAAAACACTTGAGGACGGGAGAGAAGG[G/A]
CCTACCCAGCAACGTCTAGAGCATATCTTTTTTTTTAATAATGGATTTAAATAAAACCCGGCCTCTACATCCCAAGAGATGTACACAGCCAAAGTCTAGA

Reverse complement sequence

TCTAGACTTTGGCTGTGTACATCTCTTGGGATGTAGAGGCCGGGTTTTATTTAAATCCATTATTAAAAAAAAAGATATGCTCTAGACGTTGCTGGGTAGG[C/T]
CCTTCTCTCCCGTCCTCAAGTGTTTTTGTTCTTTGCACTCTCCCCTGGAACATTTGCAGGAGGACGCTCTACTCGTGCAATGCGGCTCGTAGCTTCGATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.10% 35.80% 1.52% 22.62% NA
All Indica  2759 60.30% 22.40% 2.25% 15.01% NA
All Japonica  1512 11.80% 56.90% 0.26% 31.02% NA
Aus  269 1.10% 63.60% 1.86% 33.46% NA
Indica I  595 95.00% 4.00% 0.17% 0.84% NA
Indica II  465 60.90% 16.30% 1.94% 20.86% NA
Indica III  913 39.10% 35.70% 3.83% 21.36% NA
Indica Intermediate  786 58.40% 24.60% 2.16% 14.89% NA
Temperate Japonica  767 8.10% 82.80% 0.00% 9.13% NA
Tropical Japonica  504 10.10% 30.40% 0.79% 58.73% NA
Japonica Intermediate  241 27.40% 29.90% 0.00% 42.74% NA
VI/Aromatic  96 8.30% 14.60% 1.04% 76.04% NA
Intermediate  90 43.30% 31.10% 0.00% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0403224975 G -> DEL N N silent_mutation Average:29.553; most accessible tissue: Callus, score: 63.19 N N N N
vg0403224975 G -> A LOC_Os04g06200.1 upstream_gene_variant ; 2393.0bp to feature; MODIFIER silent_mutation Average:29.553; most accessible tissue: Callus, score: 63.19 N N N N
vg0403224975 G -> A LOC_Os04g06220.1 upstream_gene_variant ; 147.0bp to feature; MODIFIER silent_mutation Average:29.553; most accessible tissue: Callus, score: 63.19 N N N N
vg0403224975 G -> A LOC_Os04g06210.1 downstream_gene_variant ; 1506.0bp to feature; MODIFIER silent_mutation Average:29.553; most accessible tissue: Callus, score: 63.19 N N N N
vg0403224975 G -> A LOC_Os04g06210-LOC_Os04g06220 intergenic_region ; MODIFIER silent_mutation Average:29.553; most accessible tissue: Callus, score: 63.19 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0403224975 NA 4.91E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403224975 NA 7.98E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403224975 NA 1.48E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403224975 NA 1.25E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403224975 1.27E-06 NA mr1022_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403224975 NA 9.07E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403224975 NA 1.05E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403224975 NA 7.09E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403224975 NA 9.34E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403224975 NA 2.16E-07 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251