Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403224975:

Variant ID: vg0403224975 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3224975
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, G: 0.19, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

TATCGAAGCTACGAGCCGCATTGCACGAGTAGAGCGTCCTCCTGCAAATGTTCCAGGGGAGAGTGCAAAGAACAAAAACACTTGAGGACGGGAGAGAAGG[G/A]
CCTACCCAGCAACGTCTAGAGCATATCTTTTTTTTTAATAATGGATTTAAATAAAACCCGGCCTCTACATCCCAAGAGATGTACACAGCCAAAGTCTAGA

Reverse complement sequence

TCTAGACTTTGGCTGTGTACATCTCTTGGGATGTAGAGGCCGGGTTTTATTTAAATCCATTATTAAAAAAAAAGATATGCTCTAGACGTTGCTGGGTAGG[C/T]
CCTTCTCTCCCGTCCTCAAGTGTTTTTGTTCTTTGCACTCTCCCCTGGAACATTTGCAGGAGGACGCTCTACTCGTGCAATGCGGCTCGTAGCTTCGATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.10%	35.80%	1.52%	22.62%	NA
All Indica	2759	60.30%	22.40%	2.25%	15.01%	NA
All Japonica	1512	11.80%	56.90%	0.26%	31.02%	NA
Aus	269	1.10%	63.60%	1.86%	33.46%	NA
Indica I	595	95.00%	4.00%	0.17%	0.84%	NA
Indica II	465	60.90%	16.30%	1.94%	20.86%	NA
Indica III	913	39.10%	35.70%	3.83%	21.36%	NA
Indica Intermediate	786	58.40%	24.60%	2.16%	14.89%	NA
Temperate Japonica	767	8.10%	82.80%	0.00%	9.13%	NA
Tropical Japonica	504	10.10%	30.40%	0.79%	58.73%	NA
Japonica Intermediate	241	27.40%	29.90%	0.00%	42.74%	NA
VI/Aromatic	96	8.30%	14.60%	1.04%	76.04%	NA
Intermediate	90	43.30%	31.10%	0.00%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403224975	G -> DEL	N	N	silent_mutation	Average:29.553; most accessible tissue: Callus, score: 63.19	N	N	N	N
vg0403224975	G -> A	LOC_Os04g06200.1	upstream_gene_variant ; 2393.0bp to feature; MODIFIER	silent_mutation	Average:29.553; most accessible tissue: Callus, score: 63.19	N	N	N	N
vg0403224975	G -> A	LOC_Os04g06220.1	upstream_gene_variant ; 147.0bp to feature; MODIFIER	silent_mutation	Average:29.553; most accessible tissue: Callus, score: 63.19	N	N	N	N
vg0403224975	G -> A	LOC_Os04g06210.1	downstream_gene_variant ; 1506.0bp to feature; MODIFIER	silent_mutation	Average:29.553; most accessible tissue: Callus, score: 63.19	N	N	N	N
vg0403224975	G -> A	LOC_Os04g06210-LOC_Os04g06220	intergenic_region ; MODIFIER	silent_mutation	Average:29.553; most accessible tissue: Callus, score: 63.19	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403224975	NA	4.91E-06	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403224975	NA	7.98E-07	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403224975	NA	1.48E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403224975	NA	1.25E-08	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403224975	1.27E-06	NA	mr1022_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403224975	NA	9.07E-06	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403224975	NA	1.05E-08	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403224975	NA	7.09E-09	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403224975	NA	9.34E-06	mr1554_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403224975	NA	2.16E-07	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251