\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403221112:

Variant ID: vg0403221112 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 3221112
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAACTGGTAGCAGCTGTGTCATCAACACGTGACAGTCATGAGACTTTAGGTTTGTGAACTTCTTCTCCTTCATGCTTATTATTCGCTTTATATTCGTGG[T/A]
GTATCCAGATGGTACCTTGATGCTCTCCAAGCATTCAAACATACTTTCCTTCTCTGCCTTGCTAAACGTGTAGCTGGCTGGACTCAAGTAATGGCTTTCT

Reverse complement sequence

AGAAAGCCATTACTTGAGTCCAGCCAGCTACACGTTTAGCAAGGCAGAGAAGGAAAGTATGTTTGAATGCTTGGAGAGCATCAAGGTACCATCTGGATAC[A/T]
CCACGAATATAAAGCGAATAATAAGCATGAAGGAGAAGAAGTTCACAAACCTAAAGTCTCATGACTGTCACGTGTTGATGACACAGCTGCTACCAGTTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.50% 7.00% 7.77% 22.66% NA
All Indica  2759 71.00% 6.10% 8.45% 14.46% NA
All Japonica  1512 59.90% 0.50% 4.76% 34.92% NA
Aus  269 7.10% 51.70% 6.32% 34.94% NA
Indica I  595 98.30% 0.00% 1.18% 0.50% NA
Indica II  465 77.20% 0.20% 7.31% 15.27% NA
Indica III  913 47.40% 14.90% 13.69% 23.99% NA
Indica Intermediate  786 73.90% 4.10% 8.52% 13.49% NA
Temperate Japonica  767 79.80% 0.00% 1.04% 19.17% NA
Tropical Japonica  504 31.70% 0.80% 10.12% 57.34% NA
Japonica Intermediate  241 55.20% 1.20% 5.39% 38.17% NA
VI/Aromatic  96 18.80% 9.40% 36.46% 35.42% NA
Intermediate  90 62.20% 8.90% 11.11% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0403221112 T -> DEL N N silent_mutation Average:32.706; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg0403221112 T -> A LOC_Os04g06190.1 upstream_gene_variant ; 3146.0bp to feature; MODIFIER silent_mutation Average:32.706; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg0403221112 T -> A LOC_Os04g06210.1 upstream_gene_variant ; 1714.0bp to feature; MODIFIER silent_mutation Average:32.706; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg0403221112 T -> A LOC_Os04g06220.1 upstream_gene_variant ; 4010.0bp to feature; MODIFIER silent_mutation Average:32.706; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg0403221112 T -> A LOC_Os04g06200.1 downstream_gene_variant ; 133.0bp to feature; MODIFIER silent_mutation Average:32.706; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg0403221112 T -> A LOC_Os04g06190-LOC_Os04g06200 intergenic_region ; MODIFIER silent_mutation Average:32.706; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0403221112 NA 9.06E-12 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403221112 NA 4.31E-06 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403221112 3.72E-06 8.40E-19 mr1583_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403221112 NA 3.57E-09 mr1583_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403221112 NA 6.21E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403221112 NA 4.40E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403221112 NA 2.36E-06 mr1922_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251