\
| Variant ID: vg0403221112 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 3221112 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATAACTGGTAGCAGCTGTGTCATCAACACGTGACAGTCATGAGACTTTAGGTTTGTGAACTTCTTCTCCTTCATGCTTATTATTCGCTTTATATTCGTGG[T/A]
GTATCCAGATGGTACCTTGATGCTCTCCAAGCATTCAAACATACTTTCCTTCTCTGCCTTGCTAAACGTGTAGCTGGCTGGACTCAAGTAATGGCTTTCT
AGAAAGCCATTACTTGAGTCCAGCCAGCTACACGTTTAGCAAGGCAGAGAAGGAAAGTATGTTTGAATGCTTGGAGAGCATCAAGGTACCATCTGGATAC[A/T]
CCACGAATATAAAGCGAATAATAAGCATGAAGGAGAAGAAGTTCACAAACCTAAAGTCTCATGACTGTCACGTGTTGATGACACAGCTGCTACCAGTTAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.50% | 7.00% | 7.77% | 22.66% | NA |
| All Indica | 2759 | 71.00% | 6.10% | 8.45% | 14.46% | NA |
| All Japonica | 1512 | 59.90% | 0.50% | 4.76% | 34.92% | NA |
| Aus | 269 | 7.10% | 51.70% | 6.32% | 34.94% | NA |
| Indica I | 595 | 98.30% | 0.00% | 1.18% | 0.50% | NA |
| Indica II | 465 | 77.20% | 0.20% | 7.31% | 15.27% | NA |
| Indica III | 913 | 47.40% | 14.90% | 13.69% | 23.99% | NA |
| Indica Intermediate | 786 | 73.90% | 4.10% | 8.52% | 13.49% | NA |
| Temperate Japonica | 767 | 79.80% | 0.00% | 1.04% | 19.17% | NA |
| Tropical Japonica | 504 | 31.70% | 0.80% | 10.12% | 57.34% | NA |
| Japonica Intermediate | 241 | 55.20% | 1.20% | 5.39% | 38.17% | NA |
| VI/Aromatic | 96 | 18.80% | 9.40% | 36.46% | 35.42% | NA |
| Intermediate | 90 | 62.20% | 8.90% | 11.11% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0403221112 | T -> DEL | N | N | silent_mutation | Average:32.706; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| vg0403221112 | T -> A | LOC_Os04g06190.1 | upstream_gene_variant ; 3146.0bp to feature; MODIFIER | silent_mutation | Average:32.706; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| vg0403221112 | T -> A | LOC_Os04g06210.1 | upstream_gene_variant ; 1714.0bp to feature; MODIFIER | silent_mutation | Average:32.706; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| vg0403221112 | T -> A | LOC_Os04g06220.1 | upstream_gene_variant ; 4010.0bp to feature; MODIFIER | silent_mutation | Average:32.706; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| vg0403221112 | T -> A | LOC_Os04g06200.1 | downstream_gene_variant ; 133.0bp to feature; MODIFIER | silent_mutation | Average:32.706; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| vg0403221112 | T -> A | LOC_Os04g06190-LOC_Os04g06200 | intergenic_region ; MODIFIER | silent_mutation | Average:32.706; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0403221112 | NA | 9.06E-12 | mr1522 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403221112 | NA | 4.31E-06 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403221112 | 3.72E-06 | 8.40E-19 | mr1583_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403221112 | NA | 3.57E-09 | mr1583_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403221112 | NA | 6.21E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403221112 | NA | 4.40E-06 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403221112 | NA | 2.36E-06 | mr1922_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |