\
| Variant ID: vg0403207821 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 3207821 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.82, G: 0.21, others allele: 0.00, population size: 28. )
TCGCCTTGTGCAGGTCCGAGTGCATCCTATCCAATCCCCTCATCACAGCACACATGTGACCAAAGGTAGTGTCGTTCTCGCCGGCTGTTGGACGGAAGGT[G/A]
CTGACATCATCACCGTTGGCTCGACGAGGGTGGAAGCGGTACGCCGTGTCATGGAAGATGTAGTTGTGGCGCTCCCGTAGTCTGGCCATCATCAGGTATG
CATACCTGATGATGGCCAGACTACGGGAGCGCCACAACTACATCTTCCATGACACGGCGTACCGCTTCCACCCTCGTCGAGCCAACGGTGATGATGTCAG[C/T]
ACCTTCCGTCCAACAGCCGGCGAGAACGACACTACCTTTGGTCACATGTGTGCTGTGATGAGGGGATTGGATAGGATGCACTCGGACCTGCACAAGGCGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.10% | 5.40% | 34.55% | 16.00% | NA |
| All Indica | 2759 | 13.60% | 8.50% | 52.52% | 25.34% | NA |
| All Japonica | 1512 | 91.40% | 0.50% | 5.42% | 2.65% | NA |
| Aus | 269 | 72.10% | 1.10% | 26.39% | 0.37% | NA |
| Indica I | 595 | 8.60% | 4.70% | 37.98% | 48.74% | NA |
| Indica II | 465 | 15.50% | 0.60% | 45.81% | 38.06% | NA |
| Indica III | 913 | 10.30% | 18.20% | 65.06% | 6.46% | NA |
| Indica Intermediate | 786 | 20.20% | 4.80% | 52.93% | 22.01% | NA |
| Temperate Japonica | 767 | 93.60% | 0.00% | 4.04% | 2.35% | NA |
| Tropical Japonica | 504 | 89.90% | 1.40% | 6.15% | 2.58% | NA |
| Japonica Intermediate | 241 | 87.60% | 0.40% | 8.30% | 3.73% | NA |
| VI/Aromatic | 96 | 91.70% | 0.00% | 8.33% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 8.90% | 25.56% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0403207821 | G -> DEL | LOC_Os04g06160.1 | N | frameshift_variant | Average:18.41; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| vg0403207821 | G -> A | LOC_Os04g06160.1 | synonymous_variant ; p.Ser114Ser; LOW | synonymous_codon | Average:18.41; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0403207821 | 2.87E-06 | 6.87E-08 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403207821 | NA | 9.35E-06 | mr1119 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403207821 | NA | 8.28E-06 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403207821 | NA | 1.89E-07 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403207821 | NA | 7.20E-06 | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403207821 | 1.66E-07 | 7.14E-09 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403207821 | 7.73E-06 | 2.56E-06 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403207821 | 8.86E-07 | 1.40E-07 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403207821 | 4.54E-06 | 2.54E-06 | mr1120_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403207821 | 2.25E-06 | 8.03E-06 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403207821 | 5.14E-06 | 4.05E-07 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403207821 | 3.64E-06 | 2.67E-06 | mr1247_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403207821 | 2.62E-08 | 8.21E-10 | mr1496_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403207821 | 3.57E-08 | 1.96E-08 | mr1961_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |