| Variant ID: vg0403206982 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 3206982 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 94. )
TGCTGGGGTGCACACCATCGGCGCGTTCTTCACCGTTGCTGCCCTCGCCTGTCGTGCGGGTGCCAGTCCTGGTGTAGACCATCTGGAGGAAGAGCAGACG[G/A]
GGAAACGGAGAAAAACAGATGCTCAAGAACTAAGCTTTATTATATAGGAATTTAAACTGCAATTGTTCTGTTCTGAATTAAAACACTTAAAAAGCAAGCA
TGCTTGCTTTTTAAGTGTTTTAATTCAGAACAGAACAATTGCAGTTTAAATTCCTATATAATAAAGCTTAGTTCTTGAGCATCTGTTTTTCTCCGTTTCC[C/T]
CGTCTGCTCTTCCTCCAGATGGTCTACACCAGGACTGGCACCCGCACGACAGGCGAGGGCAGCAACGGTGAAGAACGCGCCGATGGTGTGCACCCCAGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.70% | 18.60% | 11.38% | 8.40% | NA |
| All Indica | 2759 | 54.70% | 22.40% | 14.50% | 8.41% | NA |
| All Japonica | 1512 | 66.30% | 15.40% | 7.87% | 10.38% | NA |
| Aus | 269 | 98.10% | 1.10% | 0.37% | 0.37% | NA |
| Indica I | 595 | 79.20% | 0.80% | 14.29% | 5.71% | NA |
| Indica II | 465 | 57.00% | 17.40% | 16.99% | 8.60% | NA |
| Indica III | 913 | 34.80% | 43.60% | 12.49% | 9.09% | NA |
| Indica Intermediate | 786 | 57.90% | 17.00% | 15.52% | 9.54% | NA |
| Temperate Japonica | 767 | 93.90% | 1.80% | 2.09% | 2.22% | NA |
| Tropical Japonica | 504 | 31.00% | 33.70% | 14.88% | 20.44% | NA |
| Japonica Intermediate | 241 | 52.70% | 20.30% | 11.62% | 15.35% | NA |
| VI/Aromatic | 96 | 74.00% | 13.50% | 10.42% | 2.08% | NA |
| Intermediate | 90 | 74.40% | 11.10% | 8.89% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0403206982 | G -> DEL | N | N | silent_mutation | Average:26.514; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg0403206982 | G -> A | LOC_Os04g06144.1 | upstream_gene_variant ; 901.0bp to feature; MODIFIER | silent_mutation | Average:26.514; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg0403206982 | G -> A | LOC_Os04g06160.1 | downstream_gene_variant ; 230.0bp to feature; MODIFIER | silent_mutation | Average:26.514; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg0403206982 | G -> A | LOC_Os04g06144-LOC_Os04g06160 | intergenic_region ; MODIFIER | silent_mutation | Average:26.514; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0403206982 | NA | 8.86E-11 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403206982 | NA | 1.88E-06 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403206982 | NA | 5.07E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403206982 | NA | 3.02E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403206982 | NA | 7.74E-06 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403206982 | NA | 4.05E-07 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403206982 | 9.83E-07 | 4.02E-15 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403206982 | NA | 1.09E-10 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403206982 | NA | 5.30E-07 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403206982 | 5.06E-06 | NA | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/