Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403206873:

Variant ID: vg0403206873 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3206873
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.02, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

TACTGCTGCATCTGCTGCATCATGGCTGCCATCATCTGAGTCTGATGTGCCATAACTTGGGCCAGTGTCGGATTTTCGGGAAGTGGTGGCGGACCATTGC[C/T]
GGAATCACTGCTGGGGTGCACACCATCGGCGCGTTCTTCACCGTTGCTGCCCTCGCCTGTCGTGCGGGTGCCAGTCCTGGTGTAGACCATCTGGAGGAAG

Reverse complement sequence

CTTCCTCCAGATGGTCTACACCAGGACTGGCACCCGCACGACAGGCGAGGGCAGCAACGGTGAAGAACGCGCCGATGGTGTGCACCCCAGCAGTGATTCC[G/A]
GCAATGGTCCGCCACCACTTCCCGAAAATCCGACACTGGCCCAAGTTATGGCACATCAGACTCAGATGATGGCAGCCATGATGCAGCAGATGCAGCAGTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.70%	13.60%	2.88%	0.78%	NA
All Indica	2759	73.60%	22.60%	3.26%	0.54%	NA
All Japonica	1512	94.80%	0.90%	2.84%	1.46%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	52.40%	44.40%	3.03%	0.17%	NA
Indica II	465	81.30%	13.10%	4.73%	0.86%	NA
Indica III	913	84.30%	13.70%	1.64%	0.33%	NA
Indica Intermediate	786	72.60%	22.00%	4.45%	0.89%	NA
Temperate Japonica	767	98.00%	0.70%	1.17%	0.13%	NA
Tropical Japonica	504	90.70%	0.40%	5.36%	3.57%	NA
Japonica Intermediate	241	93.40%	2.50%	2.90%	1.24%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	91.10%	6.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403206873	C -> DEL	N	N	silent_mutation	Average:25.055; most accessible tissue: Minghui63 young leaf, score: 49.581	N	N	N	N
vg0403206873	C -> T	LOC_Os04g06144.1	upstream_gene_variant ; 792.0bp to feature; MODIFIER	silent_mutation	Average:25.055; most accessible tissue: Minghui63 young leaf, score: 49.581	N	N	N	N
vg0403206873	C -> T	LOC_Os04g06160.1	downstream_gene_variant ; 339.0bp to feature; MODIFIER	silent_mutation	Average:25.055; most accessible tissue: Minghui63 young leaf, score: 49.581	N	N	N	N
vg0403206873	C -> T	LOC_Os04g06144-LOC_Os04g06160	intergenic_region ; MODIFIER	silent_mutation	Average:25.055; most accessible tissue: Minghui63 young leaf, score: 49.581	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403206873	2.02E-08	3.05E-40	mr1026	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	2.21E-09	6.63E-24	mr1026	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	7.50E-07	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	3.94E-06	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	3.27E-18	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	2.98E-07	2.82E-20	mr1118	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	1.41E-06	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	2.31E-07	6.31E-37	mr1161	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	2.08E-08	9.09E-22	mr1161	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	8.20E-06	mr1242	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	3.76E-06	mr1261	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	8.66E-23	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	1.81E-06	3.18E-23	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	1.30E-09	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	6.29E-09	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	3.75E-06	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	1.03E-06	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	4.03E-21	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	4.33E-24	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	2.65E-09	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	4.77E-06	3.79E-35	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	7.57E-19	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	8.24E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	4.95E-08	mr1233_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	1.83E-07	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	7.47E-29	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	9.62E-25	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	2.94E-09	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	4.54E-12	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403206873	NA	5.73E-08	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251