Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403205910:

Variant ID: vg0403205910 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 3205910
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.01, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTTGACACGAGCCTGGATAAACCTTGGCCCGGCACGCCTAGGCTTCGGGCATTTGTCGGCGAAATGGCCAAGCTCGCCACAGTTGAAACAGGACCCTG[G/T]
TTTTGCTCCAGTCTCCTTCTTTGCTTGCGCGGACGGGCCTGACTGTGCTGGTGCCACTGGTGGGCGTGGAGCTGCACCGTGGTTGGGCTGACCTCCATGG

Reverse complement sequence

CCATGGAGGTCAGCCCAACCACGGTGCAGCTCCACGCCCACCAGTGGCACCAGCACAGTCAGGCCCGTCCGCGCAAGCAAAGAAGGAGACTGGAGCAAAA[C/A]
CAGGGTCCTGTTTCAACTGTGGCGAGCTTGGCCATTTCGCCGACAAATGCCCGAAGCCTAGGCGTGCCGGGCCAAGGTTTATCCAGGCTCGTGTCAACCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.20% 15.20% 5.46% 18.18% NA
All Indica  2759 47.80% 25.20% 7.65% 19.39% NA
All Japonica  1512 77.80% 1.00% 1.72% 19.44% NA
Aus  269 98.10% 0.40% 0.74% 0.74% NA
Indica I  595 42.50% 48.70% 2.18% 6.55% NA
Indica II  465 43.70% 14.40% 11.61% 30.32% NA
Indica III  913 52.90% 15.10% 9.53% 22.45% NA
Indica Intermediate  786 48.30% 25.30% 7.25% 19.08% NA
Temperate Japonica  767 86.00% 0.80% 1.69% 11.47% NA
Tropical Japonica  504 69.60% 0.60% 0.99% 28.77% NA
Japonica Intermediate  241 68.90% 2.50% 3.32% 25.31% NA
VI/Aromatic  96 79.20% 0.00% 11.46% 9.38% NA
Intermediate  90 61.10% 8.90% 8.89% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0403205910 G -> DEL LOC_Os04g06144.1 N frameshift_variant Average:36.749; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0403205910 G -> T LOC_Os04g06144.1 missense_variant ; p.Pro58Thr; MODERATE nonsynonymous_codon ; P58T Average:36.749; most accessible tissue: Minghui63 young leaf, score: 59.171 possibly damaging 1.867 DELETERIOUS 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0403205910 1.66E-06 2.52E-42 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 1.12E-06 8.19E-21 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 1.29E-06 5.38E-10 mr1113 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 7.66E-08 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 2.09E-07 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 5.06E-18 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 2.06E-06 6.05E-20 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 5.26E-06 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 1.24E-07 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 9.93E-06 2.17E-39 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 5.69E-06 3.26E-19 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 4.50E-06 8.16E-08 mr1247 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 1.77E-21 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 3.11E-08 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 1.80E-07 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 1.30E-09 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 4.31E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 1.86E-06 mr1910 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 5.42E-06 1.00E-06 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 3.23E-08 5.66E-10 mr1113_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 6.90E-08 4.09E-10 mr1114_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 7.55E-07 2.45E-08 mr1117_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 4.83E-20 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 1.26E-22 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 2.94E-07 3.77E-08 mr1119_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 3.43E-09 1.98E-13 mr1120_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 7.15E-40 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 1.13E-19 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 1.46E-09 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 4.30E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 1.51E-08 7.00E-11 mr1247_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 3.12E-06 NA mr1258_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 1.12E-06 4.19E-06 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 3.17E-28 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 1.12E-23 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 2.66E-06 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 1.01E-12 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 8.78E-06 NA mr1913_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 3.58E-06 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910 NA 1.09E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251