\
| Variant ID: vg0403205910 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 3205910 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.01, others allele: 0.00, population size: 80. )
TGGTTGACACGAGCCTGGATAAACCTTGGCCCGGCACGCCTAGGCTTCGGGCATTTGTCGGCGAAATGGCCAAGCTCGCCACAGTTGAAACAGGACCCTG[G/T]
TTTTGCTCCAGTCTCCTTCTTTGCTTGCGCGGACGGGCCTGACTGTGCTGGTGCCACTGGTGGGCGTGGAGCTGCACCGTGGTTGGGCTGACCTCCATGG
CCATGGAGGTCAGCCCAACCACGGTGCAGCTCCACGCCCACCAGTGGCACCAGCACAGTCAGGCCCGTCCGCGCAAGCAAAGAAGGAGACTGGAGCAAAA[C/A]
CAGGGTCCTGTTTCAACTGTGGCGAGCTTGGCCATTTCGCCGACAAATGCCCGAAGCCTAGGCGTGCCGGGCCAAGGTTTATCCAGGCTCGTGTCAACCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.20% | 15.20% | 5.46% | 18.18% | NA |
| All Indica | 2759 | 47.80% | 25.20% | 7.65% | 19.39% | NA |
| All Japonica | 1512 | 77.80% | 1.00% | 1.72% | 19.44% | NA |
| Aus | 269 | 98.10% | 0.40% | 0.74% | 0.74% | NA |
| Indica I | 595 | 42.50% | 48.70% | 2.18% | 6.55% | NA |
| Indica II | 465 | 43.70% | 14.40% | 11.61% | 30.32% | NA |
| Indica III | 913 | 52.90% | 15.10% | 9.53% | 22.45% | NA |
| Indica Intermediate | 786 | 48.30% | 25.30% | 7.25% | 19.08% | NA |
| Temperate Japonica | 767 | 86.00% | 0.80% | 1.69% | 11.47% | NA |
| Tropical Japonica | 504 | 69.60% | 0.60% | 0.99% | 28.77% | NA |
| Japonica Intermediate | 241 | 68.90% | 2.50% | 3.32% | 25.31% | NA |
| VI/Aromatic | 96 | 79.20% | 0.00% | 11.46% | 9.38% | NA |
| Intermediate | 90 | 61.10% | 8.90% | 8.89% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0403205910 | G -> DEL | LOC_Os04g06144.1 | N | frameshift_variant | Average:36.749; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
| vg0403205910 | G -> T | LOC_Os04g06144.1 | missense_variant ; p.Pro58Thr; MODERATE | nonsynonymous_codon ; P58T | Average:36.749; most accessible tissue: Minghui63 young leaf, score: 59.171 | possibly damaging |
1.867 |
DELETERIOUS | 0.01 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0403205910 | 1.66E-06 | 2.52E-42 | mr1026 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | 1.12E-06 | 8.19E-21 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | 1.29E-06 | 5.38E-10 | mr1113 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 7.66E-08 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 2.09E-07 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 5.06E-18 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | 2.06E-06 | 6.05E-20 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 5.26E-06 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 1.24E-07 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | 9.93E-06 | 2.17E-39 | mr1161 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | 5.69E-06 | 3.26E-19 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | 4.50E-06 | 8.16E-08 | mr1247 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 1.77E-21 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 3.11E-08 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 1.80E-07 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 1.30E-09 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 4.31E-08 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 1.86E-06 | mr1910 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | 5.42E-06 | 1.00E-06 | mr1917 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | 3.23E-08 | 5.66E-10 | mr1113_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | 6.90E-08 | 4.09E-10 | mr1114_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | 7.55E-07 | 2.45E-08 | mr1117_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 4.83E-20 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 1.26E-22 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | 2.94E-07 | 3.77E-08 | mr1119_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | 3.43E-09 | 1.98E-13 | mr1120_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 7.15E-40 | mr1161_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 1.13E-19 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 1.46E-09 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 4.30E-06 | mr1233_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | 1.51E-08 | 7.00E-11 | mr1247_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | 3.12E-06 | NA | mr1258_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | 1.12E-06 | 4.19E-06 | mr1258_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 3.17E-28 | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 1.12E-23 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 2.66E-06 | mr1496_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 1.01E-12 | mr1794_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | 8.78E-06 | NA | mr1913_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 3.58E-06 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403205910 | NA | 1.09E-06 | mr1961_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |