RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0403205910:

Variant ID: vg0403205910 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3205910
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.01, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

TGGTTGACACGAGCCTGGATAAACCTTGGCCCGGCACGCCTAGGCTTCGGGCATTTGTCGGCGAAATGGCCAAGCTCGCCACAGTTGAAACAGGACCCTG[G/T]
TTTTGCTCCAGTCTCCTTCTTTGCTTGCGCGGACGGGCCTGACTGTGCTGGTGCCACTGGTGGGCGTGGAGCTGCACCGTGGTTGGGCTGACCTCCATGG

Reverse complement sequence

CCATGGAGGTCAGCCCAACCACGGTGCAGCTCCACGCCCACCAGTGGCACCAGCACAGTCAGGCCCGTCCGCGCAAGCAAAGAAGGAGACTGGAGCAAAA[C/A]
CAGGGTCCTGTTTCAACTGTGGCGAGCTTGGCCATTTCGCCGACAAATGCCCGAAGCCTAGGCGTGCCGGGCCAAGGTTTATCCAGGCTCGTGTCAACCA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.20%	15.20%	5.46%	18.18%	NA
All Indica	2759	47.80%	25.20%	7.65%	19.39%	NA
All Japonica	1512	77.80%	1.00%	1.72%	19.44%	NA
Aus	269	98.10%	0.40%	0.74%	0.74%	NA
Indica I	595	42.50%	48.70%	2.18%	6.55%	NA
Indica II	465	43.70%	14.40%	11.61%	30.32%	NA
Indica III	913	52.90%	15.10%	9.53%	22.45%	NA
Indica Intermediate	786	48.30%	25.30%	7.25%	19.08%	NA
Temperate Japonica	767	86.00%	0.80%	1.69%	11.47%	NA
Tropical Japonica	504	69.60%	0.60%	0.99%	28.77%	NA
Japonica Intermediate	241	68.90%	2.50%	3.32%	25.31%	NA
VI/Aromatic	96	79.20%	0.00%	11.46%	9.38%	NA
Intermediate	90	61.10%	8.90%	8.89%	21.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403205910	G -> DEL	LOC_Os04g06144.1	N	frameshift_variant	Average:36.749; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0403205910	G -> T	LOC_Os04g06144.1	missense_variant ; p.Pro58Thr; MODERATE	nonsynonymous_codon ; P58T	Average:36.749; most accessible tissue: Minghui63 young leaf, score: 59.171	possibly damaging	1.867	DELETERIOUS	0.01

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403205910	1.66E-06	2.52E-42	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910	1.12E-06	8.19E-21	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910	1.29E-06	5.38E-10	mr1113	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910	NA	7.66E-08	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910	NA	2.09E-07	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910	NA	5.06E-18	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910	2.06E-06	6.05E-20	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910	NA	5.26E-06	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910	NA	1.24E-07	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205910	9.93E-06	2.17E-39	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 40 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg0403205910:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact