\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403205317:

Variant ID: vg0403205317 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 3205317
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGTTCCCGGTGCCAAATCAATTCGGAATTCAATCTCTCTCTTGGGTGGCATGGTAGTGAGGTCTTCGGGGAACACTTCTGGATACTCGCAAACTATGGG[T/A]
ATGTCTTCCAACTTCCTCGAATTCTTCTCCTCGGTGACCACCGGGATTTCCATCTCGATCTGGTTCAAGGAGACCCCTTGCTTTGGTGAGACTAGTGATT

Reverse complement sequence

AATCACTAGTCTCACCAAAGCAAGGGGTCTCCTTGAACCAGATCGAGATGGAAATCCCGGTGGTCACCGAGGAGAAGAATTCGAGGAAGTTGGAAGACAT[A/T]
CCCATAGTTTGCGAGTATCCAGAAGTGTTCCCCGAAGACCTCACTACCATGCCACCCAAGAGAGAGATTGAATTCCGAATTGATTTGGCACCGGGAACCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.60% 22.60% 22.92% 18.83% NA
All Indica  2759 25.40% 25.00% 29.68% 19.93% NA
All Japonica  1512 56.70% 17.50% 5.49% 20.37% NA
Aus  269 19.30% 31.60% 47.96% 1.12% NA
Indica I  595 41.70% 4.90% 45.71% 7.73% NA
Indica II  465 27.50% 16.30% 25.81% 30.32% NA
Indica III  913 11.50% 45.70% 19.72% 23.11% NA
Indica Intermediate  786 27.90% 21.40% 31.42% 19.34% NA
Temperate Japonica  767 83.20% 1.80% 2.74% 12.26% NA
Tropical Japonica  504 23.80% 40.10% 6.35% 29.76% NA
Japonica Intermediate  241 41.10% 19.90% 12.45% 26.56% NA
VI/Aromatic  96 41.70% 19.80% 27.08% 11.46% NA
Intermediate  90 38.90% 12.20% 28.89% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0403205317 T -> DEL LOC_Os04g06144.1 N frameshift_variant Average:19.362; most accessible tissue: Minghui63 young leaf, score: 26.082 N N N N
vg0403205317 T -> A LOC_Os04g06144.1 synonymous_variant ; p.Ile255Ile; LOW synonymous_codon Average:19.362; most accessible tissue: Minghui63 young leaf, score: 26.082 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0403205317 2.23E-07 2.71E-34 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 2.34E-07 3.09E-21 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 NA 1.57E-06 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 NA 9.11E-17 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 6.40E-07 4.85E-20 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 NA 4.33E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 4.84E-07 2.79E-32 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 1.36E-06 1.32E-19 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 1.95E-06 1.01E-23 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 NA 7.87E-10 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 NA 4.19E-10 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 NA 1.01E-19 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 5.88E-06 3.46E-26 mr1118_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 NA 2.58E-09 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 8.10E-08 NA mr1161_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 3.82E-07 1.68E-20 mr1161_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 NA 6.73E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 NA 1.93E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 NA 2.73E-27 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 NA 3.08E-25 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 NA 1.54E-09 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 NA 9.79E-13 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 NA 2.17E-12 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205317 NA 1.69E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251