\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403205033:

Variant ID: vg0403205033 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 3205033
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATCGCAGGTCTATCTTAGAAAACACCTTAGCTCCCTTCAGTTGATCAAACAAATCATCGATCCGCGGTAAAGGATATTTATTCTTGATTGTGACCTCG[T/C]
TGAATGCTCGATAATCGACGCACATCCTCTTCGTCTTATCCTTTTTCTCCACAAAAATGACCGGAGCACCCCAAGGTGAAGTACTTGGTCGTATGTACCC

Reverse complement sequence

GGGTACATACGACCAAGTACTTCACCTTGGGGTGCTCCGGTCATTTTTGTGGAGAAAAAGGATAAGACGAAGAGGATGTGCGTCGATTATCGAGCATTCA[A/G]
CGAGGTCACAATCAAGAATAAATATCCTTTACCGCGGATCGATGATTTGTTTGATCAACTGAAGGGAGCTAAGGTGTTTTCTAAGATAGACCTGCGATCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.00% 17.60% 3.85% 22.58% NA
All Indica  2759 46.10% 23.70% 5.00% 25.23% NA
All Japonica  1512 66.30% 10.80% 1.46% 21.43% NA
Aus  269 96.70% 1.10% 0.74% 1.49% NA
Indica I  595 90.30% 0.80% 0.84% 8.07% NA
Indica II  465 34.00% 19.40% 7.31% 39.35% NA
Indica III  913 19.60% 45.10% 6.02% 29.24% NA
Indica Intermediate  786 50.50% 18.70% 5.60% 25.19% NA
Temperate Japonica  767 84.00% 2.00% 0.65% 13.43% NA
Tropical Japonica  504 47.00% 20.40% 2.18% 30.36% NA
Japonica Intermediate  241 50.20% 19.10% 2.49% 28.22% NA
VI/Aromatic  96 64.60% 2.10% 16.67% 16.67% NA
Intermediate  90 56.70% 8.90% 4.44% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0403205033 T -> C LOC_Os04g06144.1 missense_variant ; p.Asn350Ser; MODERATE nonsynonymous_codon Average:14.47; most accessible tissue: Zhenshan97 root, score: 22.162 benign 1.273 DELETERIOUS 0.00
vg0403205033 T -> DEL LOC_Os04g06144.1 N frameshift_variant Average:14.47; most accessible tissue: Zhenshan97 root, score: 22.162 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0403205033 NA 7.13E-10 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 9.09E-08 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 8.54E-09 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 3.52E-09 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 8.32E-06 mr1117 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 3.47E-09 5.72E-19 mr1118 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 2.80E-07 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 1.69E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 1.16E-09 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 2.00E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 3.57E-09 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 6.37E-06 8.49E-19 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 1.30E-06 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 3.34E-11 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 6.45E-08 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 1.64E-07 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 6.20E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 1.57E-11 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 2.07E-12 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 9.43E-06 8.19E-11 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 2.16E-14 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 3.92E-10 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 3.75E-06 5.61E-13 mr1120_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 3.23E-06 1.07E-12 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 7.77E-06 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 5.20E-07 2.88E-09 mr1258_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 2.07E-15 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 4.94E-17 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 1.83E-12 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 4.71E-06 mr1913_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033 NA 7.48E-07 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251