RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0403205033:

Variant ID: vg0403205033 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3205033
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGATCGCAGGTCTATCTTAGAAAACACCTTAGCTCCCTTCAGTTGATCAAACAAATCATCGATCCGCGGTAAAGGATATTTATTCTTGATTGTGACCTCG[T/C]
TGAATGCTCGATAATCGACGCACATCCTCTTCGTCTTATCCTTTTTCTCCACAAAAATGACCGGAGCACCCCAAGGTGAAGTACTTGGTCGTATGTACCC

Reverse complement sequence

GGGTACATACGACCAAGTACTTCACCTTGGGGTGCTCCGGTCATTTTTGTGGAGAAAAAGGATAAGACGAAGAGGATGTGCGTCGATTATCGAGCATTCA[A/G]
CGAGGTCACAATCAAGAATAAATATCCTTTACCGCGGATCGATGATTTGTTTGATCAACTGAAGGGAGCTAAGGTGTTTTCTAAGATAGACCTGCGATCA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.00%	17.60%	3.85%	22.58%	NA
All Indica	2759	46.10%	23.70%	5.00%	25.23%	NA
All Japonica	1512	66.30%	10.80%	1.46%	21.43%	NA
Aus	269	96.70%	1.10%	0.74%	1.49%	NA
Indica I	595	90.30%	0.80%	0.84%	8.07%	NA
Indica II	465	34.00%	19.40%	7.31%	39.35%	NA
Indica III	913	19.60%	45.10%	6.02%	29.24%	NA
Indica Intermediate	786	50.50%	18.70%	5.60%	25.19%	NA
Temperate Japonica	767	84.00%	2.00%	0.65%	13.43%	NA
Tropical Japonica	504	47.00%	20.40%	2.18%	30.36%	NA
Japonica Intermediate	241	50.20%	19.10%	2.49%	28.22%	NA
VI/Aromatic	96	64.60%	2.10%	16.67%	16.67%	NA
Intermediate	90	56.70%	8.90%	4.44%	30.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403205033	T -> C	LOC_Os04g06144.1	missense_variant ; p.Asn350Ser; MODERATE	nonsynonymous_codon	Average:14.47; most accessible tissue: Zhenshan97 root, score: 22.162	benign	1.273	DELETERIOUS	0.00
vg0403205033	T -> DEL	LOC_Os04g06144.1	N	frameshift_variant	Average:14.47; most accessible tissue: Zhenshan97 root, score: 22.162	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403205033	NA	7.13E-10	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033	NA	9.09E-08	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033	NA	8.54E-09	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033	NA	3.52E-09	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033	NA	8.32E-06	mr1117	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033	3.47E-09	5.72E-19	mr1118	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033	NA	2.80E-07	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033	NA	1.69E-06	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033	NA	1.16E-09	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403205033	NA	2.00E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 31 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg0403205033:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact