Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403204395:

Variant ID: vg0403204395 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3204395
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, A: 0.04, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:

CCGTGGCGGGATGCGTCGCAATAGACTTGGAAGTCTTTCATCTGGTCGGGCAGAATCAAAACTGGTGCGGATACTAATATCTTTTTGAGCTCCTCAAAAC[T/A]
CTTATCGCACTCAGCTGTCCATTTAAACTTCTCATCTTTCTTAAGCAACTGAGTCATGGGTCGGGCGATCCTGGAGAAGTTCTCGATGAATCGGCGGTAA

Reverse complement sequence

TTACCGCCGATTCATCGAGAACTTCTCCAGGATCGCCCGACCCATGACTCAGTTGCTTAAGAAAGATGAGAAGTTTAAATGGACAGCTGAGTGCGATAAG[A/T]
GTTTTGAGGAGCTCAAAAAGATATTAGTATCCGCACCAGTTTTGATTCTGCCCGACCAGATGAAAGACTTCCAAGTCTATTGCGACGCATCCCGCCACGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.20%	14.60%	4.25%	18.01%	NA
All Indica	2759	51.10%	24.10%	5.51%	19.21%	NA
All Japonica	1512	78.30%	0.90%	2.25%	18.58%	NA
Aus	269	97.80%	0.40%	1.12%	0.74%	NA
Indica I	595	42.90%	47.10%	2.02%	8.07%	NA
Indica II	465	49.00%	13.80%	7.96%	29.25%	NA
Indica III	913	57.20%	14.70%	6.02%	22.12%	NA
Indica Intermediate	786	51.70%	23.90%	6.11%	18.32%	NA
Temperate Japonica	767	85.80%	0.70%	1.69%	11.86%	NA
Tropical Japonica	504	71.60%	0.40%	2.58%	25.40%	NA
Japonica Intermediate	241	68.50%	2.50%	3.32%	25.73%	NA
VI/Aromatic	96	76.00%	0.00%	5.21%	18.75%	NA
Intermediate	90	61.10%	8.90%	7.78%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403204395	T -> DEL	LOC_Os04g06144.1	N	frameshift_variant	Average:8.771; most accessible tissue: Callus, score: 17.086	N	N	N	N
vg0403204395	T -> A	LOC_Os04g06144.1	missense_variant ; p.Ser563Cys; MODERATE	nonsynonymous_codon ; S563C	Average:8.771; most accessible tissue: Callus, score: 17.086	benign	1.167	DELETERIOUS	0.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403204395	NA	1.33E-32	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	1.01E-16	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	1.28E-06	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	1.84E-06	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	4.01E-06	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	2.71E-16	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	9.86E-17	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	5.68E-15	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	3.18E-06	NA	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	5.36E-07	1.62E-22	mr1495	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	6.32E-08	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	6.07E-06	mr1789	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	1.29E-09	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	5.81E-06	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	1.52E-20	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	1.07E-22	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	7.01E-08	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	6.41E-06	2.36E-35	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	5.24E-19	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	1.95E-06	mr1233_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	1.25E-06	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	3.09E-28	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	8.19E-24	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	4.96E-08	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	4.76E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	6.80E-14	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	3.11E-07	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403204395	NA	2.69E-06	mr1961_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251