Variant ID: vg0403204227 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 3204227 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 42. )
GTATATACTTTGCAGCGGTTGCCAATCAGATAGTGCCTCCAGATCTTCAAAGCATGGACCACTGCTGCCAATTCCAGGTCATGAGTTGGATAATTCCCTT[C/T]
GTGTGGACGCAACTGCCGCGAGGCATACGCAACCACTCTGCCCTCTTGCATTAGGACACATCCAAGTCCGTGGCGGGATGCGTCGCAATAGACTTGGAAG
CTTCCAAGTCTATTGCGACGCATCCCGCCACGGACTTGGATGTGTCCTAATGCAAGAGGGCAGAGTGGTTGCGTATGCCTCGCGGCAGTTGCGTCCACAC[G/A]
AAGGGAATTATCCAACTCATGACCTGGAATTGGCAGCAGTGGTCCATGCTTTGAAGATCTGGAGGCACTATCTGATTGGCAACCGCTGCAAAGTATATAC
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 60.30% | 14.90% | 3.24% | 21.63% | NA |
All Indica | 2759 | 46.80% | 24.60% | 4.20% | 24.36% | NA |
All Japonica | 1512 | 77.70% | 0.90% | 1.39% | 19.97% | NA |
Aus | 269 | 97.40% | 0.40% | 0.74% | 1.49% | NA |
Indica I | 595 | 43.00% | 47.70% | 1.01% | 8.24% | NA |
Indica II | 465 | 42.60% | 14.20% | 5.59% | 37.63% | NA |
Indica III | 913 | 51.90% | 15.10% | 5.15% | 27.82% | NA |
Indica Intermediate | 786 | 46.20% | 24.40% | 4.71% | 24.68% | NA |
Temperate Japonica | 767 | 85.70% | 0.80% | 0.91% | 12.65% | NA |
Tropical Japonica | 504 | 70.00% | 0.40% | 2.18% | 27.38% | NA |
Japonica Intermediate | 241 | 68.50% | 2.50% | 1.24% | 27.80% | NA |
VI/Aromatic | 96 | 71.90% | 0.00% | 7.29% | 20.83% | NA |
Intermediate | 90 | 57.80% | 7.80% | 7.78% | 26.67% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0403204227 | C -> DEL | LOC_Os04g06144.1 | N | frameshift_variant | Average:8.63; most accessible tissue: Minghui63 root, score: 17.665 | N | N | N | N |
vg0403204227 | C -> T | LOC_Os04g06144.1 | missense_variant ; p.Glu619Lys; MODERATE | nonsynonymous_codon ; E619K | Average:8.63; most accessible tissue: Minghui63 root, score: 17.665 | benign | 0.954 | DELETERIOUS | 0.01 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0403204227 | NA | 4.81E-10 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0403204227 | NA | 1.93E-09 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0403204227 | NA | 3.29E-12 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0403204227 | NA | 5.78E-08 | mr1789 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0403204227 | NA | 1.97E-10 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |