\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403196295:

Variant ID: vg0403196295 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 3196295
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


TCACATCTGGAGCATCTTGAGCTTCTGCAGCAGTAACATGGTTGACACGGGCCTTTGGTGCTGGTGCGGTAGAGTTGCTCTGTGTAGGGACAACCTTCAC[G/A]
CGTCGGGGCTTCGGACACTTGTCAGCGTAATGTCCTGGTTCACCACAGTTGAAACACACCACGGGCTTGCTGCCTTGCTCCCTCTTGGCAGATTGTTGTT

Reverse complement sequence

AACAACAATCTGCCAAGAGGGAGCAAGGCAGCAAGCCCGTGGTGTGTTTCAACTGTGGTGAACCAGGACATTACGCTGACAAGTGTCCGAAGCCCCGACG[C/T]
GTGAAGGTTGTCCCTACACAGAGCAACTCTACCGCACCAGCACCAAAGGCCCGTGTCAACCATGTTACTGCTGCAGAAGCTCAAGATGCTCCAGATGTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.40% 13.60% 0.80% 1.16% NA
All Indica  2759 82.20% 17.50% 0.22% 0.04% NA
All Japonica  1512 86.80% 10.10% 1.59% 1.59% NA
Aus  269 96.70% 0.00% 0.00% 3.35% NA
Indica I  595 97.00% 3.00% 0.00% 0.00% NA
Indica II  465 78.30% 21.30% 0.43% 0.00% NA
Indica III  913 70.80% 29.10% 0.11% 0.00% NA
Indica Intermediate  786 86.80% 12.70% 0.38% 0.13% NA
Temperate Japonica  767 99.10% 0.40% 0.52% 0.00% NA
Tropical Japonica  504 65.90% 27.40% 1.98% 4.76% NA
Japonica Intermediate  241 91.30% 4.60% 4.15% 0.00% NA
VI/Aromatic  96 74.00% 1.00% 6.25% 18.75% NA
Intermediate  90 85.60% 8.90% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0403196295 G -> DEL LOC_Os04g06144.1 N frameshift_variant Average:50.091; most accessible tissue: Minghui63 young leaf, score: 63.571 N N N N
vg0403196295 G -> A LOC_Os04g06144.1 synonymous_variant ; p.Arg1622Arg; LOW synonymous_codon Average:50.091; most accessible tissue: Minghui63 young leaf, score: 63.571 N N N N
vg0403196295 G -> A LOC_Os04g06144.1 synonymous_variant ; p.Arg1622Arg; LOW nonsynonymous_codon ; R1622H Average:50.091; most accessible tissue: Minghui63 young leaf, score: 63.571 probably damaging 2.33 DELETERIOUS 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0403196295 NA 6.31E-08 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403196295 NA 3.23E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403196295 1.25E-08 1.23E-09 mr1439 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403196295 NA 1.60E-06 mr1439 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403196295 NA 2.10E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403196295 NA 6.51E-08 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251