Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403196295:

Variant ID: vg0403196295 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3196295
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

TCACATCTGGAGCATCTTGAGCTTCTGCAGCAGTAACATGGTTGACACGGGCCTTTGGTGCTGGTGCGGTAGAGTTGCTCTGTGTAGGGACAACCTTCAC[G/A]
CGTCGGGGCTTCGGACACTTGTCAGCGTAATGTCCTGGTTCACCACAGTTGAAACACACCACGGGCTTGCTGCCTTGCTCCCTCTTGGCAGATTGTTGTT

Reverse complement sequence

AACAACAATCTGCCAAGAGGGAGCAAGGCAGCAAGCCCGTGGTGTGTTTCAACTGTGGTGAACCAGGACATTACGCTGACAAGTGTCCGAAGCCCCGACG[C/T]
GTGAAGGTTGTCCCTACACAGAGCAACTCTACCGCACCAGCACCAAAGGCCCGTGTCAACCATGTTACTGCTGCAGAAGCTCAAGATGCTCCAGATGTGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.40%	13.60%	0.80%	1.16%	NA
All Indica	2759	82.20%	17.50%	0.22%	0.04%	NA
All Japonica	1512	86.80%	10.10%	1.59%	1.59%	NA
Aus	269	96.70%	0.00%	0.00%	3.35%	NA
Indica I	595	97.00%	3.00%	0.00%	0.00%	NA
Indica II	465	78.30%	21.30%	0.43%	0.00%	NA
Indica III	913	70.80%	29.10%	0.11%	0.00%	NA
Indica Intermediate	786	86.80%	12.70%	0.38%	0.13%	NA
Temperate Japonica	767	99.10%	0.40%	0.52%	0.00%	NA
Tropical Japonica	504	65.90%	27.40%	1.98%	4.76%	NA
Japonica Intermediate	241	91.30%	4.60%	4.15%	0.00%	NA
VI/Aromatic	96	74.00%	1.00%	6.25%	18.75%	NA
Intermediate	90	85.60%	8.90%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403196295	G -> DEL	LOC_Os04g06144.1	N	frameshift_variant	Average:50.091; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N
vg0403196295	G -> A	LOC_Os04g06144.1	synonymous_variant ; p.Arg1622Arg; LOW	synonymous_codon	Average:50.091; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N
vg0403196295	G -> A	LOC_Os04g06144.1	synonymous_variant ; p.Arg1622Arg; LOW	nonsynonymous_codon ; R1622H	Average:50.091; most accessible tissue: Minghui63 young leaf, score: 63.571	probably damaging	2.33	DELETERIOUS	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403196295	NA	6.31E-08	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403196295	NA	3.23E-06	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403196295	1.25E-08	1.23E-09	mr1439	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403196295	NA	1.60E-06	mr1439	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403196295	NA	2.10E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403196295	NA	6.51E-08	mr1852	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251