\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403174609:

Variant ID: vg0403174609 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 3174609
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGCATACAATTGATGTTCCCGCAACATTCCCAACACCAGACGGAGATGCTGTTGATGGTCTTCCTCTGATTGTGAGTTTACCAGGATGTCGTCGATGAA[A/G]
ACCACAACAAACTTATCCAAGTATTCCATGAACACTTTGTTCATTAAGTTCATGAAGAAGGCAGGAGCATTGGTCAGCCCGAACGACATCACCGTGAATT

Reverse complement sequence

AATTCACGGTGATGTCGTTCGGGCTGACCAATGCTCCTGCCTTCTTCATGAACTTAATGAACAAAGTGTTCATGGAATACTTGGATAAGTTTGTTGTGGT[T/C]
TTCATCGACGACATCCTGGTAAACTCACAATCAGAGGAAGACCATCAACAGCATCTCCGTCTGGTGTTGGGAATGTTGCGGGAACATCAATTGTATGCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.20% 1.20% 5.92% 7.60% NA
All Indica  2759 94.00% 1.50% 4.35% 0.14% NA
All Japonica  1512 68.20% 0.50% 7.94% 23.41% NA
Aus  269 86.20% 3.00% 10.78% 0.00% NA
Indica I  595 97.80% 0.50% 1.68% 0.00% NA
Indica II  465 95.50% 1.30% 3.23% 0.00% NA
Indica III  913 89.80% 2.20% 7.56% 0.44% NA
Indica Intermediate  786 95.00% 1.70% 3.31% 0.00% NA
Temperate Japonica  767 85.40% 0.00% 3.52% 11.08% NA
Tropical Japonica  504 48.80% 1.00% 11.11% 39.09% NA
Japonica Intermediate  241 53.90% 0.80% 15.35% 29.88% NA
VI/Aromatic  96 90.60% 1.00% 8.33% 0.00% NA
Intermediate  90 94.40% 1.10% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0403174609 A -> DEL LOC_Os04g06110.1 N frameshift_variant Average:8.863; most accessible tissue: Callus, score: 18.928 N N N N
vg0403174609 A -> G LOC_Os04g06110.1 synonymous_variant ; p.Val618Val; LOW synonymous_codon Average:8.863; most accessible tissue: Callus, score: 18.928 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0403174609 NA 1.15E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403174609 NA 3.98E-09 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403174609 NA 5.47E-06 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403174609 NA 5.55E-09 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403174609 NA 1.11E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403174609 NA 1.81E-11 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403174609 NA 6.27E-09 mr1680_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403174609 NA 1.05E-10 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403174609 NA 1.43E-10 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403174609 NA 7.63E-07 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251