Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403136311:

Variant ID: vg0403136311 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3136311
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGGTACCGATCCCCTCACCAACACAAGGCAAATCATTACCTTTCTTTTGTTCAATGCGGTCTTCTACCCTGTCACGCCCAAAAATTTAGCCCAAATTTT[T/C]
AGACTATTTTGTGTATAAATTCTTGTCCAGGAATCAAGCCAGGGCACACAAAACGACATGTAAATATACATATCCAAACGTAAATAAAGCGTAAATACTT

Reverse complement sequence

AAGTATTTACGCTTTATTTACGTTTGGATATGTATATTTACATGTCGTTTTGTGTGCCCTGGCTTGATTCCTGGACAAGAATTTATACACAAAATAGTCT[A/G]
AAAATTTGGGCTAAATTTTTGGGCGTGACAGGGTAGAAGACCGCATTGAACAAAAGAAAGGTAATGATTTGCCTTGTGTTGGTGAGGGGATCGGTACCTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.70%	9.10%	0.74%	30.39%	NA
All Indica	2759	68.60%	10.40%	0.83%	20.15%	NA
All Japonica	1512	55.20%	5.60%	0.73%	38.56%	NA
Aus	269	12.30%	0.40%	0.00%	87.36%	NA
Indica I	595	97.60%	0.30%	0.34%	1.68%	NA
Indica II	465	73.80%	3.00%	1.72%	21.51%	NA
Indica III	913	45.00%	21.60%	0.66%	32.75%	NA
Indica Intermediate	786	71.00%	9.40%	0.89%	18.70%	NA
Temperate Japonica	767	74.30%	7.60%	0.39%	17.73%	NA
Tropical Japonica	504	28.00%	4.20%	0.99%	66.87%	NA
Japonica Intermediate	241	51.00%	2.10%	1.24%	45.64%	NA
VI/Aromatic	96	10.40%	46.90%	0.00%	42.71%	NA
Intermediate	90	58.90%	16.70%	1.11%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403136311	T -> C	LOC_Os04g06050.1	downstream_gene_variant ; 3127.0bp to feature; MODIFIER	silent_mutation	Average:20.798; most accessible tissue: Callus, score: 52.125	N	N	N	N
vg0403136311	T -> C	LOC_Os04g06030-LOC_Os04g06050	intergenic_region ; MODIFIER	silent_mutation	Average:20.798; most accessible tissue: Callus, score: 52.125	N	N	N	N
vg0403136311	T -> DEL	N	N	silent_mutation	Average:20.798; most accessible tissue: Callus, score: 52.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403136311	1.10E-08	NA	mr1114	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403136311	1.84E-07	NA	mr1117	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403136311	6.96E-06	3.70E-06	mr1117	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403136311	1.04E-06	NA	mr1119	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403136311	8.64E-06	NA	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403136311	3.65E-07	NA	mr1117_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403136311	5.11E-06	NA	mr1119_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251