| Variant ID: vg0403136311 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 3136311 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GAGGTACCGATCCCCTCACCAACACAAGGCAAATCATTACCTTTCTTTTGTTCAATGCGGTCTTCTACCCTGTCACGCCCAAAAATTTAGCCCAAATTTT[T/C]
AGACTATTTTGTGTATAAATTCTTGTCCAGGAATCAAGCCAGGGCACACAAAACGACATGTAAATATACATATCCAAACGTAAATAAAGCGTAAATACTT
AAGTATTTACGCTTTATTTACGTTTGGATATGTATATTTACATGTCGTTTTGTGTGCCCTGGCTTGATTCCTGGACAAGAATTTATACACAAAATAGTCT[A/G]
AAAATTTGGGCTAAATTTTTGGGCGTGACAGGGTAGAAGACCGCATTGAACAAAAGAAAGGTAATGATTTGCCTTGTGTTGGTGAGGGGATCGGTACCTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.70% | 9.10% | 0.74% | 30.39% | NA |
| All Indica | 2759 | 68.60% | 10.40% | 0.83% | 20.15% | NA |
| All Japonica | 1512 | 55.20% | 5.60% | 0.73% | 38.56% | NA |
| Aus | 269 | 12.30% | 0.40% | 0.00% | 87.36% | NA |
| Indica I | 595 | 97.60% | 0.30% | 0.34% | 1.68% | NA |
| Indica II | 465 | 73.80% | 3.00% | 1.72% | 21.51% | NA |
| Indica III | 913 | 45.00% | 21.60% | 0.66% | 32.75% | NA |
| Indica Intermediate | 786 | 71.00% | 9.40% | 0.89% | 18.70% | NA |
| Temperate Japonica | 767 | 74.30% | 7.60% | 0.39% | 17.73% | NA |
| Tropical Japonica | 504 | 28.00% | 4.20% | 0.99% | 66.87% | NA |
| Japonica Intermediate | 241 | 51.00% | 2.10% | 1.24% | 45.64% | NA |
| VI/Aromatic | 96 | 10.40% | 46.90% | 0.00% | 42.71% | NA |
| Intermediate | 90 | 58.90% | 16.70% | 1.11% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0403136311 | T -> C | LOC_Os04g06050.1 | downstream_gene_variant ; 3127.0bp to feature; MODIFIER | silent_mutation | Average:20.798; most accessible tissue: Callus, score: 52.125 | N | N | N | N |
| vg0403136311 | T -> C | LOC_Os04g06030-LOC_Os04g06050 | intergenic_region ; MODIFIER | silent_mutation | Average:20.798; most accessible tissue: Callus, score: 52.125 | N | N | N | N |
| vg0403136311 | T -> DEL | N | N | silent_mutation | Average:20.798; most accessible tissue: Callus, score: 52.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0403136311 | 1.10E-08 | NA | mr1114 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403136311 | 1.84E-07 | NA | mr1117 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403136311 | 6.96E-06 | 3.70E-06 | mr1117 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403136311 | 1.04E-06 | NA | mr1119 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403136311 | 8.64E-06 | NA | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403136311 | 3.65E-07 | NA | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403136311 | 5.11E-06 | NA | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |