RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0403131494:

Variant ID: vg0403131494 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3131494
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGGATTACGCGTTTGACAGAGATGGGAGGCGGGGATCGATCTGGACCGTTCGGTTTTCACAGGATGAATCTGATCTATTGAGTGATGAATGAAAGAATG[A/G]
AAGGATGAGTGAAAGTATTTGTTGAATTATAGAGTAGATTAAGGTTTCCCAACTCTTCGCGCCAAACACAGCATAAAATTGTTCATTTATCCTCAAAAAA

Reverse complement sequence

TTTTTTGAGGATAAATGAACAATTTTATGCTGTGTTTGGCGCGAAGAGTTGGGAAACCTTAATCTACTCTATAATTCAACAAATACTTTCACTCATCCTT[T/C]
CATTCTTTCATTCATCACTCAATAGATCAGATTCATCCTGTGAAAACCGAACGGTCCAGATCGATCCCCGCCTCCCATCTCTGTCAAACGCGTAATCCCC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.20%	3.00%	9.52%	19.30%	NA
All Indica	2759	69.60%	4.70%	13.12%	12.58%	NA
All Japonica	1512	74.30%	0.20%	4.50%	21.03%	NA
Aus	269	20.10%	0.00%	4.09%	75.84%	NA
Indica I	595	45.70%	13.40%	40.17%	0.67%	NA
Indica II	465	80.20%	3.40%	6.88%	9.46%	NA
Indica III	913	74.90%	0.00%	2.96%	22.12%	NA
Indica Intermediate	786	75.10%	4.50%	8.14%	12.34%	NA
Temperate Japonica	767	86.70%	0.00%	4.82%	8.47%	NA
Tropical Japonica	504	56.30%	0.00%	3.97%	39.68%	NA
Japonica Intermediate	241	72.20%	1.20%	4.56%	21.99%	NA
VI/Aromatic	96	65.60%	0.00%	2.08%	32.29%	NA
Intermediate	90	71.10%	7.80%	7.78%	13.33%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403131494	A -> DEL	N	N	silent_mutation	Average:31.946; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0403131494	A -> G	LOC_Os04g06030.1	upstream_gene_variant ; 2798.0bp to feature; MODIFIER	silent_mutation	Average:31.946; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0403131494	A -> G	LOC_Os04g06030-LOC_Os04g06050	intergenic_region ; MODIFIER	silent_mutation	Average:31.946; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403131494	NA	3.02E-07	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403131494	NA	3.86E-08	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403131494	NA	1.11E-09	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403131494	NA	9.21E-07	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403131494	NA	3.65E-07	mr1904_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 5 of 5 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0403131494:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact