Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403060294:

Variant ID: vg0403060294 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3060294
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 47. )

Flanking Sequence (100 bp) in Reference Genome:

TGACAGTGTTGATGGAAAACACGGTGGCCTAGGAGATTTGCTTCAATTCAGTACAGGTCCAACGCTTGCCTCTAGTGGCAAGAGCGTACCGGCTGGTTTG[A/C]
TCCTGCAACCAGCAAGAAAGACAATAAACCGTAACTAGATGAACAATAGCCGATTTGCCAATTAGGGCCGATGACGTATCGTCAGGACCCAGCCGATATG

Reverse complement sequence

CATATCGGCTGGGTCCTGACGATACGTCATCGGCCCTAATTGGCAAATCGGCTATTGTTCATCTAGTTACGGTTTATTGTCTTTCTTGCTGGTTGCAGGA[T/G]
CAAACCAGCCGGTACGCTCTTGCCACTAGAGGCAAGCGTTGGACCTGTACTGAATTGAAGCAAATCTCCTAGGCCACCGTGTTTTCCATCAACACTGTCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.00%	34.70%	10.56%	16.67%	NA
All Indica	2759	58.10%	22.90%	11.78%	7.25%	NA
All Japonica	1512	9.70%	47.30%	6.42%	36.64%	NA
Aus	269	1.10%	73.20%	17.10%	8.55%	NA
Indica I	595	90.60%	8.20%	0.84%	0.34%	NA
Indica II	465	49.90%	25.80%	18.06%	6.24%	NA
Indica III	913	44.80%	28.70%	15.33%	11.17%	NA
Indica Intermediate	786	53.70%	25.60%	12.21%	8.52%	NA
Temperate Japonica	767	2.90%	72.80%	3.78%	20.60%	NA
Tropical Japonica	504	12.50%	14.10%	10.32%	63.10%	NA
Japonica Intermediate	241	25.30%	35.70%	6.64%	32.37%	NA
VI/Aromatic	96	6.20%	67.70%	18.75%	7.29%	NA
Intermediate	90	45.60%	35.60%	14.44%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403060294	A -> C	LOC_Os04g05910.1	upstream_gene_variant ; 3186.0bp to feature; MODIFIER	silent_mutation	Average:30.67; most accessible tissue: Zhenshan97 flag leaf, score: 67.31	N	N	N	N
vg0403060294	A -> C	LOC_Os04g05900.1	downstream_gene_variant ; 3936.0bp to feature; MODIFIER	silent_mutation	Average:30.67; most accessible tissue: Zhenshan97 flag leaf, score: 67.31	N	N	N	N
vg0403060294	A -> C	LOC_Os04g05920.1	downstream_gene_variant ; 3506.0bp to feature; MODIFIER	silent_mutation	Average:30.67; most accessible tissue: Zhenshan97 flag leaf, score: 67.31	N	N	N	N
vg0403060294	A -> C	LOC_Os04g05910-LOC_Os04g05920	intergenic_region ; MODIFIER	silent_mutation	Average:30.67; most accessible tissue: Zhenshan97 flag leaf, score: 67.31	N	N	N	N
vg0403060294	A -> DEL	N	N	silent_mutation	Average:30.67; most accessible tissue: Zhenshan97 flag leaf, score: 67.31	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403060294	6.57E-07	4.24E-10	mr1588_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251