\
| Variant ID: vg0403055424 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 3055424 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTGGATTGCCCAAGACATCAACAGGATATGATTCCATTTGGGTGATCGTGGATCGCCTCACCAAGACGGCGAGATTCATTCCCGTTAAGACAAATTATAG[C/T]
AGTGCTAAGCTAGCCGAGTTATACATGACCAGGATAGTATGTCTTCATGGATGTACCTAAGATAATTATATCTGATCGAGGCACACAGTTTACCTCGCAT
ATGCGAGGTAAACTGTGTGCCTCGATCAGATATAATTATCTTAGGTACATCCATGAAGACATACTATCCTGGTCATGTATAACTCGGCTAGCTTAGCACT[G/A]
CTATAATTTGTCTTAACGGGAATGAATCTCGCCGTCTTGGTGAGGCGATCCACGATCACCCAAATGGAATCATATCCTGTTGATGTCTTGGGCAATCCAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.70% | 3.40% | 18.15% | 17.75% | NA |
| All Indica | 2759 | 60.10% | 0.10% | 17.80% | 22.00% | NA |
| All Japonica | 1512 | 54.40% | 10.40% | 22.09% | 13.03% | NA |
| Aus | 269 | 92.90% | 0.00% | 3.35% | 3.72% | NA |
| Indica I | 595 | 30.10% | 0.00% | 9.08% | 60.84% | NA |
| Indica II | 465 | 81.50% | 0.40% | 11.61% | 6.45% | NA |
| Indica III | 913 | 63.70% | 0.00% | 27.16% | 9.09% | NA |
| Indica Intermediate | 786 | 65.90% | 0.10% | 17.18% | 16.79% | NA |
| Temperate Japonica | 767 | 73.50% | 1.70% | 11.21% | 13.56% | NA |
| Tropical Japonica | 504 | 36.10% | 23.60% | 32.74% | 7.54% | NA |
| Japonica Intermediate | 241 | 32.00% | 10.80% | 34.44% | 22.82% | NA |
| VI/Aromatic | 96 | 77.10% | 0.00% | 10.42% | 12.50% | NA |
| Intermediate | 90 | 70.00% | 0.00% | 15.56% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0403055424 | C -> DEL | LOC_Os04g05900.1 | N | frameshift_variant | Average:9.027; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| vg0403055424 | C -> T | LOC_Os04g05900.1 | synonymous_variant ; p.Ser958Ser; LOW | synonymous_codon | Average:9.027; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0403055424 | 3.09E-15 | 1.85E-31 | mr1301 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403055424 | 4.16E-07 | 7.24E-20 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403055424 | 4.79E-15 | 1.48E-27 | mr1410 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403055424 | 2.47E-06 | 9.12E-18 | mr1410 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403055424 | NA | 1.59E-31 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403055424 | NA | 5.20E-08 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403055424 | NA | 6.26E-09 | mr1993 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403055424 | 6.21E-14 | 1.96E-31 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403055424 | 4.63E-06 | 2.26E-20 | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403055424 | 1.65E-11 | 1.44E-25 | mr1410_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403055424 | NA | 2.65E-16 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403055424 | NA | 8.11E-29 | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403055424 | NA | 2.37E-09 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403055424 | 7.35E-06 | NA | mr1798_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403055424 | 2.36E-08 | 6.57E-15 | mr1993_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403055424 | 2.48E-06 | 1.33E-13 | mr1993_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |