\
| Variant ID: vg0403035005 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 3035005 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.86, C: 0.15, others allele: 0.00, population size: 62. )
AGGCCCTGTTTGTGCATTTGACAAAAAAAATTCTGGGTTGTGTGCCCCATCAAGATCTTATTATTCTCTTTCAAAATTGTCAATGTATCAGTAGACAAAC[C/A]
AGCAGATGTTTGGGTGTTCGTTTATAATCTAAATGCCTGTAATGCTTATTTTGGATTGTAACATTTTTTACAGCATGTATATTGTACATTAAATCTACTG
CAGTAGATTTAATGTACAATATACATGCTGTAAAAAATGTTACAATCCAAAATAAGCATTACAGGCATTTAGATTATAAACGAACACCCAAACATCTGCT[G/T]
GTTTGTCTACTGATACATTGACAATTTTGAAAGAGAATAATAAGATCTTGATGGGGCACACAACCCAGAATTTTTTTTGTCAAATGCACAAACAGGGCCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.10% | 19.00% | 0.30% | 37.60% | NA |
| All Indica | 2759 | 62.30% | 6.60% | 0.25% | 30.84% | NA |
| All Japonica | 1512 | 13.90% | 36.70% | 0.26% | 49.14% | NA |
| Aus | 269 | 2.20% | 53.90% | 0.37% | 43.49% | NA |
| Indica I | 595 | 90.30% | 7.90% | 0.00% | 1.85% | NA |
| Indica II | 465 | 53.30% | 11.80% | 0.43% | 34.41% | NA |
| Indica III | 913 | 52.10% | 1.40% | 0.22% | 46.22% | NA |
| Indica Intermediate | 786 | 58.30% | 8.50% | 0.38% | 32.82% | NA |
| Temperate Japonica | 767 | 9.90% | 63.10% | 0.39% | 26.60% | NA |
| Tropical Japonica | 504 | 13.30% | 5.20% | 0.20% | 81.35% | NA |
| Japonica Intermediate | 241 | 27.80% | 18.70% | 0.00% | 53.53% | NA |
| VI/Aromatic | 96 | 55.20% | 2.10% | 1.04% | 41.67% | NA |
| Intermediate | 90 | 54.40% | 15.60% | 1.11% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0403035005 | C -> DEL | N | N | silent_mutation | Average:8.339; most accessible tissue: Callus, score: 17.314 | N | N | N | N |
| vg0403035005 | C -> A | LOC_Os04g05880.1 | intron_variant ; MODIFIER | silent_mutation | Average:8.339; most accessible tissue: Callus, score: 17.314 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0403035005 | NA | 1.73E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403035005 | NA | 1.98E-06 | mr1183 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403035005 | NA | 1.88E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403035005 | NA | 2.85E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403035005 | NA | 2.23E-07 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |