\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402921204:

Variant ID: vg0402921204 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2921204
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


AACTAACCATCAAGCTACTCATCAATCTAGGTAAGGGGGGGTGTGTCTCGCATACTATCCAAAAACCATCTGAAGCGAGATCGAAACTGCAATAATCCTC[T/C]
AGTCTAGTCATCCGACCATCCGCAGGATCCTGGGGCAGGTAGAAGGTGGTCGCGGGCACGGGCAAACCTGAGTCCCCATGGCTCGGAAGTAGTGGCCTCT

Reverse complement sequence

AGAGGCCACTACTTCCGAGCCATGGGGACTCAGGTTTGCCCGTGCCCGCGACCACCTTCTACCTGCCCCAGGATCCTGCGGATGGTCGGATGACTAGACT[A/G]
GAGGATTATTGCAGTTTCGATCTCGCTTCAGATGGTTTTTGGATAGTATGCGAGACACACCCCCCCTTACCTAGATTGATGAGTAGCTTGATGGTTAGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.50% 1.60% 18.62% 17.22% NA
All Indica  2759 40.20% 2.50% 30.41% 26.89% NA
All Japonica  1512 96.40% 0.30% 1.26% 2.12% NA
Aus  269 89.20% 0.00% 3.35% 7.43% NA
Indica I  595 13.40% 1.70% 18.82% 66.05% NA
Indica II  465 31.20% 4.90% 48.17% 15.70% NA
Indica III  913 56.80% 2.20% 28.59% 12.38% NA
Indica Intermediate  786 46.30% 2.20% 30.79% 20.74% NA
Temperate Japonica  767 94.40% 0.30% 1.83% 3.52% NA
Tropical Japonica  504 98.60% 0.20% 0.60% 0.60% NA
Japonica Intermediate  241 97.90% 0.40% 0.83% 0.83% NA
VI/Aromatic  96 96.90% 1.00% 0.00% 2.08% NA
Intermediate  90 64.40% 1.10% 14.44% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402921204 T -> C LOC_Os04g05720.1 upstream_gene_variant ; 687.0bp to feature; MODIFIER silent_mutation Average:39.47; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N
vg0402921204 T -> C LOC_Os04g05710.1 intron_variant ; MODIFIER silent_mutation Average:39.47; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N
vg0402921204 T -> DEL N N silent_mutation Average:39.47; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402921204 1.26E-06 3.78E-10 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402921204 NA 5.76E-06 mr1550 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402921204 1.96E-07 9.24E-11 mr1757 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402921204 NA 2.26E-07 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402921204 NA 4.21E-07 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251