RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0402921204:

Variant ID: vg0402921204 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2921204
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

AACTAACCATCAAGCTACTCATCAATCTAGGTAAGGGGGGGTGTGTCTCGCATACTATCCAAAAACCATCTGAAGCGAGATCGAAACTGCAATAATCCTC[T/C]
AGTCTAGTCATCCGACCATCCGCAGGATCCTGGGGCAGGTAGAAGGTGGTCGCGGGCACGGGCAAACCTGAGTCCCCATGGCTCGGAAGTAGTGGCCTCT

Reverse complement sequence

AGAGGCCACTACTTCCGAGCCATGGGGACTCAGGTTTGCCCGTGCCCGCGACCACCTTCTACCTGCCCCAGGATCCTGCGGATGGTCGGATGACTAGACT[A/G]
GAGGATTATTGCAGTTTCGATCTCGCTTCAGATGGTTTTTGGATAGTATGCGAGACACACCCCCCCTTACCTAGATTGATGAGTAGCTTGATGGTTAGTT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.50%	1.60%	18.62%	17.22%	NA
All Indica	2759	40.20%	2.50%	30.41%	26.89%	NA
All Japonica	1512	96.40%	0.30%	1.26%	2.12%	NA
Aus	269	89.20%	0.00%	3.35%	7.43%	NA
Indica I	595	13.40%	1.70%	18.82%	66.05%	NA
Indica II	465	31.20%	4.90%	48.17%	15.70%	NA
Indica III	913	56.80%	2.20%	28.59%	12.38%	NA
Indica Intermediate	786	46.30%	2.20%	30.79%	20.74%	NA
Temperate Japonica	767	94.40%	0.30%	1.83%	3.52%	NA
Tropical Japonica	504	98.60%	0.20%	0.60%	0.60%	NA
Japonica Intermediate	241	97.90%	0.40%	0.83%	0.83%	NA
VI/Aromatic	96	96.90%	1.00%	0.00%	2.08%	NA
Intermediate	90	64.40%	1.10%	14.44%	20.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402921204	T -> C	LOC_Os04g05720.1	upstream_gene_variant ; 687.0bp to feature; MODIFIER	silent_mutation	Average:39.47; most accessible tissue: Minghui63 young leaf, score: 71.254	N	N	N	N
vg0402921204	T -> C	LOC_Os04g05710.1	intron_variant ; MODIFIER	silent_mutation	Average:39.47; most accessible tissue: Minghui63 young leaf, score: 71.254	N	N	N	N
vg0402921204	T -> DEL	N	N	silent_mutation	Average:39.47; most accessible tissue: Minghui63 young leaf, score: 71.254	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402921204	1.26E-06	3.78E-10	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402921204	NA	5.76E-06	mr1550	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402921204	1.96E-07	9.24E-11	mr1757	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402921204	NA	2.26E-07	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402921204	NA	4.21E-07	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 5 of 5 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0402921204:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact