Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402919583:

Variant ID: vg0402919583 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2919583
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTTGTTAACCAATCCATACCTAATATAACATCAAGGGTCTGTGGTACCAAGACCATAAGGTTAGAGGGAAATACCACATCCCTAAGGCGAATAGGTAC[A/G]
TCAATGCAAGCTGTATCCACGGCTATTTCACCCCCAGGTGAATGTACTAACATTGGTTGCCTTAGTTTAACTCTGGTCAAATTGTGTCGTTGGCTTGCTT

Reverse complement sequence

AAGCAAGCCAACGACACAATTTGACCAGAGTTAAACTAAGGCAACCAATGTTAGTACATTCACCTGGGGGTGAAATAGCCGTGGATACAGCTTGCATTGA[T/C]
GTACCTATTCGCCTTAGGGATGTGGTATTTCCCTCTAACCTTATGGTCTTGGTACCACAGACCCTTGATGTTATATTAGGTATGGATTGGTTAACAAAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.50% 20.10% 8.17% 7.32% NA
All Indica  2759 71.90% 7.90% 11.78% 8.41% NA
All Japonica  1512 49.30% 46.70% 0.79% 3.17% NA
Aus  269 74.70% 3.30% 13.01% 8.92% NA
Indica I  595 30.90% 6.40% 34.96% 27.73% NA
Indica II  465 73.80% 18.10% 5.16% 3.01% NA
Indica III  913 93.00% 2.50% 3.50% 0.99% NA
Indica Intermediate  786 77.50% 9.20% 7.76% 5.60% NA
Temperate Japonica  767 13.00% 81.70% 1.17% 4.04% NA
Tropical Japonica  504 89.50% 6.90% 0.60% 2.98% NA
Japonica Intermediate  241 80.90% 18.30% 0.00% 0.83% NA
VI/Aromatic  96 56.20% 2.10% 4.17% 37.50% NA
Intermediate  90 66.70% 15.60% 11.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402919583 A -> DEL LOC_Os04g05710.1 N frameshift_variant Average:39.698; most accessible tissue: Minghui63 flag leaf, score: 89.325 N N N N
vg0402919583 A -> G LOC_Os04g05710.1 synonymous_variant ; p.Asp516Asp; LOW synonymous_codon Average:39.698; most accessible tissue: Minghui63 flag leaf, score: 89.325 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0402919583 A G 0.01 0.01 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402919583 NA 2.10E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402919583 NA 1.69E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402919583 3.41E-06 5.09E-06 mr1062_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251