\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402918909:

Variant ID: vg0402918909 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2918909
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.27, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CATGAACACTTTGTTCATAAGATTCATAAAGTATGCCGGGGCGTTGGTTAACCCAAACGACATTACTGTGAACTTATACAATCCATAGCGTGTTGAAAAC[G/A]
CGGTCTTAGGTATATCCCCGGTCCTAATTTTCAATTGGTGGTATCCTGATCGAAGGTCAATCTTAGAGAACACCTTAGCTCCTTTAAGTTGATCGAAAAG

Reverse complement sequence

CTTTTCGATCAACTTAAAGGAGCTAAGGTGTTCTCTAAGATTGACCTTCGATCAGGATACCACCAATTGAAAATTAGGACCGGGGATATACCTAAGACCG[C/T]
GTTTTCAACACGCTATGGATTGTATAAGTTCACAGTAATGTCGTTTGGGTTAACCAACGCCCCGGCATACTTTATGAATCTTATGAACAAAGTGTTCATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.00% 22.70% 3.24% 0.11% NA
All Indica  2759 84.20% 14.20% 1.63% 0.04% NA
All Japonica  1512 58.90% 39.30% 1.52% 0.26% NA
Aus  269 75.10% 5.20% 19.70% 0.00% NA
Indica I  595 95.50% 4.00% 0.34% 0.17% NA
Indica II  465 95.30% 4.10% 0.65% 0.00% NA
Indica III  913 70.90% 27.10% 2.08% 0.00% NA
Indica Intermediate  786 84.50% 12.80% 2.67% 0.00% NA
Temperate Japonica  767 88.70% 9.80% 1.04% 0.52% NA
Tropical Japonica  504 19.80% 77.40% 2.78% 0.00% NA
Japonica Intermediate  241 46.10% 53.50% 0.41% 0.00% NA
VI/Aromatic  96 21.90% 46.90% 31.25% 0.00% NA
Intermediate  90 67.80% 30.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402918909 G -> DEL LOC_Os04g05710.1 N frameshift_variant Average:36.368; most accessible tissue: Minghui63 flag leaf, score: 86.618 N N N N
vg0402918909 G -> A LOC_Os04g05710.1 missense_variant ; p.Ala741Val; MODERATE nonsynonymous_codon ; A741M Average:36.368; most accessible tissue: Minghui63 flag leaf, score: 86.618 probably damaging 3.014 DELETERIOUS 0.00
vg0402918909 G -> A LOC_Os04g05710.1 missense_variant ; p.Ala741Val; MODERATE nonsynonymous_codon ; A741V Average:36.368; most accessible tissue: Minghui63 flag leaf, score: 86.618 possibly damaging 1.697 DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0402918909 G A 0.0 -0.01 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402918909 NA 5.02E-11 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402918909 NA 2.88E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402918909 NA 3.75E-06 mr1438_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402918909 5.31E-06 NA mr1563_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402918909 2.15E-06 9.37E-13 mr1563_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251