Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402824534:

Variant ID: vg0402824534 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2824534
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.11, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

TGTAGTCATGTATTATCCGTTTCAACATATAAGTATTTACTAGAAAAATACCCGTGCATTGCGACGGGTAAATACTGTTTTAATTTTATTATTGTTATAC[A/G]
GTTTAGTTATGGTAAAATTCACTGTGGGAATTCGTTTCGATTTATTTTTAAAAAATCATGAGCTGCAGTTAGGAGTCCGACTTTTCATCTCAAGTTAGTA

Reverse complement sequence

TACTAACTTGAGATGAAAAGTCGGACTCCTAACTGCAGCTCATGATTTTTTAAAAATAAATCGAAACGAATTCCCACAGTGAATTTTACCATAACTAAAC[T/C]
GTATAACAATAATAAAATTAAAACAGTATTTACCCGTCGCAATGCACGGGTATTTTTCTAGTAAATACTTATATGTTGAAACGGATAATACATGACTACA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.80%	16.70%	2.31%	10.14%	NA
All Indica	2759	59.10%	21.70%	3.37%	15.84%	NA
All Japonica	1512	96.10%	1.80%	0.20%	1.92%	NA
Aus	269	40.10%	55.40%	2.60%	1.86%	NA
Indica I	595	69.10%	0.20%	5.71%	25.04%	NA
Indica II	465	65.20%	16.60%	2.58%	15.70%	NA
Indica III	913	46.20%	41.80%	2.52%	9.42%	NA
Indica Intermediate	786	63.00%	17.60%	3.05%	16.41%	NA
Temperate Japonica	767	99.50%	0.10%	0.13%	0.26%	NA
Tropical Japonica	504	93.30%	4.40%	0.00%	2.38%	NA
Japonica Intermediate	241	91.30%	1.70%	0.83%	6.22%	NA
VI/Aromatic	96	94.80%	3.10%	1.04%	1.04%	NA
Intermediate	90	71.10%	15.60%	5.56%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402824534	A -> DEL	N	N	silent_mutation	Average:25.118; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0402824534	A -> G	LOC_Os04g05570.1	upstream_gene_variant ; 2641.0bp to feature; MODIFIER	silent_mutation	Average:25.118; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0402824534	A -> G	LOC_Os04g05580.1	upstream_gene_variant ; 1616.0bp to feature; MODIFIER	silent_mutation	Average:25.118; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0402824534	A -> G	LOC_Os04g05570-LOC_Os04g05580	intergenic_region ; MODIFIER	silent_mutation	Average:25.118; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402824534	NA	3.82E-06	mr1523	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402824534	1.93E-06	NA	mr1111_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402824534	NA	2.09E-07	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402824534	5.27E-06	NA	mr1144_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402824534	NA	3.22E-07	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402824534	7.95E-06	NA	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402824534	NA	8.89E-06	mr1726_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251