Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0402783378:

Variant ID: vg0402783378 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2783378
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, T: 0.25, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

CTGTTCACTTCATTATCAGGCAGTTTCGTTCTTAAGGTTACAATATCATGATTTCTTTAAAGGGGTACAACTATAAATAAAATCCTGTGATAATTCACGG[G/T]
GGGGAGATTGCTTGTGATAATTTTATTGTGCTTAAGAACGAACGTTATGCATACTATGGTAAAAAAAAACGAAGCAGATGCGCACAGTAGAAAATGATGA

Reverse complement sequence

TCATCATTTTCTACTGTGCGCATCTGCTTCGTTTTTTTTTACCATAGTATGCATAACGTTCGTTCTTAAGCACAATAAAATTATCACAAGCAATCTCCCC[C/A]
CCGTGAATTATCACAGGATTTTATTTATAGTTGTACCCCTTTAAAGAAATCATGATATTGTAACCTTAAGAACGAAACTGCCTGATAATGAAGTGAACAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.20%	35.30%	0.70%	17.80%	NA
All Indica	2759	73.30%	6.10%	0.40%	20.22%	NA
All Japonica	1512	7.30%	83.70%	0.73%	8.27%	NA
Aus	269	1.90%	55.80%	3.72%	38.66%	NA
Indica I	595	90.90%	2.50%	0.00%	6.55%	NA
Indica II	465	66.70%	10.30%	0.43%	22.58%	NA
Indica III	913	70.80%	3.80%	0.55%	24.86%	NA
Indica Intermediate	786	66.70%	9.00%	0.51%	23.79%	NA
Temperate Japonica	767	1.40%	95.20%	0.65%	2.74%	NA
Tropical Japonica	504	8.50%	71.60%	0.99%	18.85%	NA
Japonica Intermediate	241	23.20%	72.60%	0.41%	3.73%	NA
VI/Aromatic	96	5.20%	53.10%	0.00%	41.67%	NA
Intermediate	90	45.60%	37.80%	1.11%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402783378	G -> DEL	N	N	silent_mutation	Average:22.012; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg0402783378	G -> T	LOC_Os04g05500.1	upstream_gene_variant ; 1427.0bp to feature; MODIFIER	silent_mutation	Average:22.012; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg0402783378	G -> T	LOC_Os04g05520.1	upstream_gene_variant ; 4018.0bp to feature; MODIFIER	silent_mutation	Average:22.012; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg0402783378	G -> T	LOC_Os04g05510.1	downstream_gene_variant ; 1814.0bp to feature; MODIFIER	silent_mutation	Average:22.012; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg0402783378	G -> T	LOC_Os04g05500-LOC_Os04g05510	intergenic_region ; MODIFIER	silent_mutation	Average:22.012; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402783378	2.42E-06	NA	mr1767	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402783378	NA	2.02E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251