\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402783378:

Variant ID: vg0402783378 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2783378
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, T: 0.25, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


CTGTTCACTTCATTATCAGGCAGTTTCGTTCTTAAGGTTACAATATCATGATTTCTTTAAAGGGGTACAACTATAAATAAAATCCTGTGATAATTCACGG[G/T]
GGGGAGATTGCTTGTGATAATTTTATTGTGCTTAAGAACGAACGTTATGCATACTATGGTAAAAAAAAACGAAGCAGATGCGCACAGTAGAAAATGATGA

Reverse complement sequence

TCATCATTTTCTACTGTGCGCATCTGCTTCGTTTTTTTTTACCATAGTATGCATAACGTTCGTTCTTAAGCACAATAAAATTATCACAAGCAATCTCCCC[C/A]
CCGTGAATTATCACAGGATTTTATTTATAGTTGTACCCCTTTAAAGAAATCATGATATTGTAACCTTAAGAACGAAACTGCCTGATAATGAAGTGAACAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.20% 35.30% 0.70% 17.80% NA
All Indica  2759 73.30% 6.10% 0.40% 20.22% NA
All Japonica  1512 7.30% 83.70% 0.73% 8.27% NA
Aus  269 1.90% 55.80% 3.72% 38.66% NA
Indica I  595 90.90% 2.50% 0.00% 6.55% NA
Indica II  465 66.70% 10.30% 0.43% 22.58% NA
Indica III  913 70.80% 3.80% 0.55% 24.86% NA
Indica Intermediate  786 66.70% 9.00% 0.51% 23.79% NA
Temperate Japonica  767 1.40% 95.20% 0.65% 2.74% NA
Tropical Japonica  504 8.50% 71.60% 0.99% 18.85% NA
Japonica Intermediate  241 23.20% 72.60% 0.41% 3.73% NA
VI/Aromatic  96 5.20% 53.10% 0.00% 41.67% NA
Intermediate  90 45.60% 37.80% 1.11% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402783378 G -> DEL N N silent_mutation Average:22.012; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg0402783378 G -> T LOC_Os04g05500.1 upstream_gene_variant ; 1427.0bp to feature; MODIFIER silent_mutation Average:22.012; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg0402783378 G -> T LOC_Os04g05520.1 upstream_gene_variant ; 4018.0bp to feature; MODIFIER silent_mutation Average:22.012; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg0402783378 G -> T LOC_Os04g05510.1 downstream_gene_variant ; 1814.0bp to feature; MODIFIER silent_mutation Average:22.012; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg0402783378 G -> T LOC_Os04g05500-LOC_Os04g05510 intergenic_region ; MODIFIER silent_mutation Average:22.012; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402783378 2.42E-06 NA mr1767 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402783378 NA 2.02E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251