| Variant ID: vg0402722439 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2722439 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGCATTGCAAAGGGGGAAATCGTGACAATACCCTTTCCACAACACAACTCAAAACAGTGCACCATTCCTGGATCATAATCACCCCCTTATAAACAAGGCA[C/T]
GGACTCCCCAGCGACCCCCGTGGACTTCTCGCCACTTCTCAGTCTGGCGCACTATAATGAATCACCCTATACAAAAGATAAAACCGTTGCCCACGCTGGC
GCCAGCGTGGGCAACGGTTTTATCTTTTGTATAGGGTGATTCATTATAGTGCGCCAGACTGAGAAGTGGCGAGAAGTCCACGGGGGTCGCTGGGGAGTCC[G/A]
TGCCTTGTTTATAAGGGGGTGATTATGATCCAGGAATGGTGCACTGTTTTGAGTTGTGTTGTGGAAAGGGTATTGTCACGATTTCCCCCTTTGCAATGCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 21.90% | 3.40% | 60.56% | 14.18% | NA |
| All Indica | 2759 | 5.70% | 4.40% | 83.15% | 6.74% | NA |
| All Japonica | 1512 | 52.80% | 1.30% | 15.08% | 30.89% | NA |
| Aus | 269 | 4.50% | 3.30% | 90.33% | 1.86% | NA |
| Indica I | 595 | 1.80% | 4.50% | 77.31% | 16.30% | NA |
| Indica II | 465 | 13.80% | 1.50% | 76.77% | 7.96% | NA |
| Indica III | 913 | 1.80% | 6.80% | 90.80% | 0.66% | NA |
| Indica Intermediate | 786 | 8.40% | 3.30% | 82.44% | 5.85% | NA |
| Temperate Japonica | 767 | 84.00% | 0.30% | 7.95% | 7.82% | NA |
| Tropical Japonica | 504 | 17.50% | 3.00% | 21.03% | 58.53% | NA |
| Japonica Intermediate | 241 | 27.40% | 0.80% | 25.31% | 46.47% | NA |
| VI/Aromatic | 96 | 44.80% | 9.40% | 42.71% | 3.12% | NA |
| Intermediate | 90 | 26.70% | 1.10% | 62.22% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402722439 | C -> DEL | N | N | silent_mutation | Average:14.515; most accessible tissue: Callus, score: 27.14 | N | N | N | N |
| vg0402722439 | C -> T | LOC_Os04g05420.1 | upstream_gene_variant ; 1424.0bp to feature; MODIFIER | silent_mutation | Average:14.515; most accessible tissue: Callus, score: 27.14 | N | N | N | N |
| vg0402722439 | C -> T | LOC_Os04g05430.2 | downstream_gene_variant ; 3945.0bp to feature; MODIFIER | silent_mutation | Average:14.515; most accessible tissue: Callus, score: 27.14 | N | N | N | N |
| vg0402722439 | C -> T | LOC_Os04g05420-LOC_Os04g05430 | intergenic_region ; MODIFIER | silent_mutation | Average:14.515; most accessible tissue: Callus, score: 27.14 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402722439 | 7.19E-06 | 1.30E-06 | mr1796 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402722439 | NA | 1.93E-10 | mr1864 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402722439 | NA | 5.73E-06 | mr1990 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402722439 | NA | 9.69E-09 | mr1521_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |