\
| Variant ID: vg0402720584 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2720584 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, C: 0.22, G: 0.06, others allele: 0.00, population size: 72. )
ACCAAGGTGAAGCTAGTTCTGTCAGAGAGAATTATATTCTGGTAGAAAAGATCACTTGCGAATTCTGGCCTCGACTTGTGGGTACTATATCCTGGCCTCC[C/A]
GCTGCTGATATTCATCGGCATCATTGGTTTGGGCTGTTCCTCCTTGTCTATTAGGAGTTGGGCGAGATTCTTCTTTCCTCCATGCACTTAACAGAAGATT
AATCTTCTGTTAAGTGCATGGAGGAAAGAAGAATCTCGCCCAACTCCTAATAGACAAGGAGGAACAGCCCAAACCAATGATGCCGATGAATATCAGCAGC[G/T]
GGAGGCCAGGATATAGTACCCACAAGTCGAGGCCAGAATTCGCAAGTGATCTTTTCTACCAGAATATAATTCTCTCTGACAGAACTAGCTTCACCTTGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.10% | 21.10% | 0.30% | 34.47% | NA |
| All Indica | 2759 | 60.40% | 4.90% | 0.25% | 34.51% | NA |
| All Japonica | 1512 | 7.30% | 52.20% | 0.40% | 40.08% | NA |
| Aus | 269 | 82.50% | 3.70% | 0.00% | 13.75% | NA |
| Indica I | 595 | 93.30% | 1.80% | 0.17% | 4.71% | NA |
| Indica II | 465 | 54.20% | 12.50% | 0.43% | 32.90% | NA |
| Indica III | 913 | 46.80% | 0.50% | 0.00% | 52.68% | NA |
| Indica Intermediate | 786 | 55.00% | 7.60% | 0.51% | 36.90% | NA |
| Temperate Japonica | 767 | 2.70% | 82.90% | 0.78% | 13.56% | NA |
| Tropical Japonica | 504 | 15.10% | 17.30% | 0.00% | 67.66% | NA |
| Japonica Intermediate | 241 | 5.80% | 27.40% | 0.00% | 66.80% | NA |
| VI/Aromatic | 96 | 47.90% | 43.80% | 0.00% | 8.33% | NA |
| Intermediate | 90 | 45.60% | 24.40% | 1.11% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402720584 | C -> DEL | N | N | silent_mutation | Average:13.697; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0402720584 | C -> A | LOC_Os04g05420.1 | 5_prime_UTR_premature_start_codon_gain_variant ; LOW | silent_mutation | Average:13.697; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0402720584 | C -> A | LOC_Os04g05420.1 | 5_prime_UTR_variant ; 2186.0bp to feature; MODIFIER | silent_mutation | Average:13.697; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402720584 | NA | 1.78E-09 | mr1864 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402720584 | NA | 2.45E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402720584 | NA | 3.93E-08 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402720584 | NA | 9.65E-06 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402720584 | NA | 8.90E-12 | mr1521_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402720584 | NA | 9.99E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402720584 | NA | 3.66E-07 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402720584 | NA | 2.67E-07 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402720584 | NA | 3.88E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402720584 | NA | 2.38E-11 | mr1844_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |