\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402720584:

Variant ID: vg0402720584 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2720584
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, C: 0.22, G: 0.06, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


ACCAAGGTGAAGCTAGTTCTGTCAGAGAGAATTATATTCTGGTAGAAAAGATCACTTGCGAATTCTGGCCTCGACTTGTGGGTACTATATCCTGGCCTCC[C/A]
GCTGCTGATATTCATCGGCATCATTGGTTTGGGCTGTTCCTCCTTGTCTATTAGGAGTTGGGCGAGATTCTTCTTTCCTCCATGCACTTAACAGAAGATT

Reverse complement sequence

AATCTTCTGTTAAGTGCATGGAGGAAAGAAGAATCTCGCCCAACTCCTAATAGACAAGGAGGAACAGCCCAAACCAATGATGCCGATGAATATCAGCAGC[G/T]
GGAGGCCAGGATATAGTACCCACAAGTCGAGGCCAGAATTCGCAAGTGATCTTTTCTACCAGAATATAATTCTCTCTGACAGAACTAGCTTCACCTTGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.10% 21.10% 0.30% 34.47% NA
All Indica  2759 60.40% 4.90% 0.25% 34.51% NA
All Japonica  1512 7.30% 52.20% 0.40% 40.08% NA
Aus  269 82.50% 3.70% 0.00% 13.75% NA
Indica I  595 93.30% 1.80% 0.17% 4.71% NA
Indica II  465 54.20% 12.50% 0.43% 32.90% NA
Indica III  913 46.80% 0.50% 0.00% 52.68% NA
Indica Intermediate  786 55.00% 7.60% 0.51% 36.90% NA
Temperate Japonica  767 2.70% 82.90% 0.78% 13.56% NA
Tropical Japonica  504 15.10% 17.30% 0.00% 67.66% NA
Japonica Intermediate  241 5.80% 27.40% 0.00% 66.80% NA
VI/Aromatic  96 47.90% 43.80% 0.00% 8.33% NA
Intermediate  90 45.60% 24.40% 1.11% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402720584 C -> DEL N N silent_mutation Average:13.697; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0402720584 C -> A LOC_Os04g05420.1 5_prime_UTR_premature_start_codon_gain_variant ; LOW silent_mutation Average:13.697; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0402720584 C -> A LOC_Os04g05420.1 5_prime_UTR_variant ; 2186.0bp to feature; MODIFIER silent_mutation Average:13.697; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402720584 NA 1.78E-09 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402720584 NA 2.45E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402720584 NA 3.93E-08 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402720584 NA 9.65E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402720584 NA 8.90E-12 mr1521_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402720584 NA 9.99E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402720584 NA 3.66E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402720584 NA 2.67E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402720584 NA 3.88E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402720584 NA 2.38E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251