\
| Variant ID: vg0402671824 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2671824 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 81. )
CAGAATTTAACATCTGCTTCCAACCTATGTAAATAGTGAGAAAAATTCTAAAAATAAGTCGAGATGTACTTTGTAATGCAGCTACCATCTTACATTGTCA[A/G]
AAGGGCAAGTACTATCTAGTACTTTGCGAGTTACTTGAACTAAACGACGTGCATCACAAACTTCCACCATCCCACACCACTAGCATCCCAAGGTCATGTT
AACATGACCTTGGGATGCTAGTGGTGTGGGATGGTGGAAGTTTGTGATGCACGTCGTTTAGTTCAAGTAACTCGCAAAGTACTAGATAGTACTTGCCCTT[T/C]
TGACAATGTAAGATGGTAGCTGCATTACAAAGTACATCTCGACTTATTTTTAGAATTTTTCTCACTATTTACATAGGTTGGAAGCAGATGTTAAATTCTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.90% | 7.20% | 14.37% | 29.48% | NA |
| All Indica | 2759 | 35.30% | 12.00% | 22.80% | 29.94% | NA |
| All Japonica | 1512 | 71.10% | 0.20% | 1.79% | 26.92% | NA |
| Aus | 269 | 62.10% | 0.70% | 1.12% | 36.06% | NA |
| Indica I | 595 | 8.40% | 10.30% | 40.00% | 41.34% | NA |
| Indica II | 465 | 19.60% | 12.90% | 24.73% | 42.80% | NA |
| Indica III | 913 | 59.40% | 11.90% | 11.94% | 16.76% | NA |
| Indica Intermediate | 786 | 36.90% | 12.80% | 21.25% | 29.01% | NA |
| Temperate Japonica | 767 | 91.00% | 0.10% | 0.91% | 7.95% | NA |
| Tropical Japonica | 504 | 46.40% | 0.00% | 2.78% | 50.79% | NA |
| Japonica Intermediate | 241 | 59.30% | 0.80% | 2.49% | 37.34% | NA |
| VI/Aromatic | 96 | 56.20% | 0.00% | 4.17% | 39.58% | NA |
| Intermediate | 90 | 47.80% | 6.70% | 17.78% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402671824 | A -> DEL | N | N | silent_mutation | Average:20.937; most accessible tissue: Callus, score: 70.619 | N | N | N | N |
| vg0402671824 | A -> G | LOC_Os04g05360.1 | upstream_gene_variant ; 1978.0bp to feature; MODIFIER | silent_mutation | Average:20.937; most accessible tissue: Callus, score: 70.619 | N | N | N | N |
| vg0402671824 | A -> G | LOC_Os04g05370.1 | downstream_gene_variant ; 4144.0bp to feature; MODIFIER | silent_mutation | Average:20.937; most accessible tissue: Callus, score: 70.619 | N | N | N | N |
| vg0402671824 | A -> G | LOC_Os04g05360-LOC_Os04g05370 | intergenic_region ; MODIFIER | silent_mutation | Average:20.937; most accessible tissue: Callus, score: 70.619 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402671824 | NA | 8.07E-08 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402671824 | NA | 1.33E-09 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402671824 | NA | 1.13E-12 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402671824 | NA | 2.01E-13 | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402671824 | NA | 2.23E-06 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402671824 | 3.27E-06 | NA | mr1835 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402671824 | NA | 1.01E-07 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402671824 | NA | 1.60E-08 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |