\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402671824:

Variant ID: vg0402671824 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2671824
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


CAGAATTTAACATCTGCTTCCAACCTATGTAAATAGTGAGAAAAATTCTAAAAATAAGTCGAGATGTACTTTGTAATGCAGCTACCATCTTACATTGTCA[A/G]
AAGGGCAAGTACTATCTAGTACTTTGCGAGTTACTTGAACTAAACGACGTGCATCACAAACTTCCACCATCCCACACCACTAGCATCCCAAGGTCATGTT

Reverse complement sequence

AACATGACCTTGGGATGCTAGTGGTGTGGGATGGTGGAAGTTTGTGATGCACGTCGTTTAGTTCAAGTAACTCGCAAAGTACTAGATAGTACTTGCCCTT[T/C]
TGACAATGTAAGATGGTAGCTGCATTACAAAGTACATCTCGACTTATTTTTAGAATTTTTCTCACTATTTACATAGGTTGGAAGCAGATGTTAAATTCTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.90% 7.20% 14.37% 29.48% NA
All Indica  2759 35.30% 12.00% 22.80% 29.94% NA
All Japonica  1512 71.10% 0.20% 1.79% 26.92% NA
Aus  269 62.10% 0.70% 1.12% 36.06% NA
Indica I  595 8.40% 10.30% 40.00% 41.34% NA
Indica II  465 19.60% 12.90% 24.73% 42.80% NA
Indica III  913 59.40% 11.90% 11.94% 16.76% NA
Indica Intermediate  786 36.90% 12.80% 21.25% 29.01% NA
Temperate Japonica  767 91.00% 0.10% 0.91% 7.95% NA
Tropical Japonica  504 46.40% 0.00% 2.78% 50.79% NA
Japonica Intermediate  241 59.30% 0.80% 2.49% 37.34% NA
VI/Aromatic  96 56.20% 0.00% 4.17% 39.58% NA
Intermediate  90 47.80% 6.70% 17.78% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402671824 A -> DEL N N silent_mutation Average:20.937; most accessible tissue: Callus, score: 70.619 N N N N
vg0402671824 A -> G LOC_Os04g05360.1 upstream_gene_variant ; 1978.0bp to feature; MODIFIER silent_mutation Average:20.937; most accessible tissue: Callus, score: 70.619 N N N N
vg0402671824 A -> G LOC_Os04g05370.1 downstream_gene_variant ; 4144.0bp to feature; MODIFIER silent_mutation Average:20.937; most accessible tissue: Callus, score: 70.619 N N N N
vg0402671824 A -> G LOC_Os04g05360-LOC_Os04g05370 intergenic_region ; MODIFIER silent_mutation Average:20.937; most accessible tissue: Callus, score: 70.619 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402671824 NA 8.07E-08 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402671824 NA 1.33E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402671824 NA 1.13E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402671824 NA 2.01E-13 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402671824 NA 2.23E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402671824 3.27E-06 NA mr1835 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402671824 NA 1.01E-07 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402671824 NA 1.60E-08 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251