Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402671824:

Variant ID: vg0402671824 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2671824
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

CAGAATTTAACATCTGCTTCCAACCTATGTAAATAGTGAGAAAAATTCTAAAAATAAGTCGAGATGTACTTTGTAATGCAGCTACCATCTTACATTGTCA[A/G]
AAGGGCAAGTACTATCTAGTACTTTGCGAGTTACTTGAACTAAACGACGTGCATCACAAACTTCCACCATCCCACACCACTAGCATCCCAAGGTCATGTT

Reverse complement sequence

AACATGACCTTGGGATGCTAGTGGTGTGGGATGGTGGAAGTTTGTGATGCACGTCGTTTAGTTCAAGTAACTCGCAAAGTACTAGATAGTACTTGCCCTT[T/C]
TGACAATGTAAGATGGTAGCTGCATTACAAAGTACATCTCGACTTATTTTTAGAATTTTTCTCACTATTTACATAGGTTGGAAGCAGATGTTAAATTCTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.90%	7.20%	14.37%	29.48%	NA
All Indica	2759	35.30%	12.00%	22.80%	29.94%	NA
All Japonica	1512	71.10%	0.20%	1.79%	26.92%	NA
Aus	269	62.10%	0.70%	1.12%	36.06%	NA
Indica I	595	8.40%	10.30%	40.00%	41.34%	NA
Indica II	465	19.60%	12.90%	24.73%	42.80%	NA
Indica III	913	59.40%	11.90%	11.94%	16.76%	NA
Indica Intermediate	786	36.90%	12.80%	21.25%	29.01%	NA
Temperate Japonica	767	91.00%	0.10%	0.91%	7.95%	NA
Tropical Japonica	504	46.40%	0.00%	2.78%	50.79%	NA
Japonica Intermediate	241	59.30%	0.80%	2.49%	37.34%	NA
VI/Aromatic	96	56.20%	0.00%	4.17%	39.58%	NA
Intermediate	90	47.80%	6.70%	17.78%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402671824	A -> DEL	N	N	silent_mutation	Average:20.937; most accessible tissue: Callus, score: 70.619	N	N	N	N
vg0402671824	A -> G	LOC_Os04g05360.1	upstream_gene_variant ; 1978.0bp to feature; MODIFIER	silent_mutation	Average:20.937; most accessible tissue: Callus, score: 70.619	N	N	N	N
vg0402671824	A -> G	LOC_Os04g05370.1	downstream_gene_variant ; 4144.0bp to feature; MODIFIER	silent_mutation	Average:20.937; most accessible tissue: Callus, score: 70.619	N	N	N	N
vg0402671824	A -> G	LOC_Os04g05360-LOC_Os04g05370	intergenic_region ; MODIFIER	silent_mutation	Average:20.937; most accessible tissue: Callus, score: 70.619	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402671824	NA	8.07E-08	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402671824	NA	1.33E-09	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402671824	NA	1.13E-12	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402671824	NA	2.01E-13	mr1732	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402671824	NA	2.23E-06	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402671824	3.27E-06	NA	mr1835	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402671824	NA	1.01E-07	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402671824	NA	1.60E-08	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251