Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402546694:

Variant ID: vg0402546694 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2546694
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.36, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:

AGGCGACGCATCGTCCTCTGCCGACGTTGGCAAGCAACCCCTGGTGACTGCCCTCCCTCATAAGCATCTCTCCCTAGCAGGGATGGCCCAGTGCCGCTCT[A/G]
AGGGCCTCTACTACAATTGCAACAAGAAGTACGTCGCCAGACTTCGCTGCTAGAAGTCCTTCGTCATTGAGTTCATCACGTTGGGTGAATCGAGCATATC

Reverse complement sequence

GATATGCTCGATTCACCCAACGTGATGAACTCAATGACGAAGGACTTCTAGCAGCGAAGTCTGGCGACGTACTTCTTGTTGCAATTGTAGTAGAGGCCCT[T/C]
AGAGCGGCACTGGGCCATCCCTGCTAGGGAGAGATGCTTATGAGGGAGGGCAGTCACCAGGGGTTGCTTGCCAACGTCGGCAGAGGACGATGCGTCGCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.60%	17.10%	1.54%	38.76%	NA
All Indica	2759	62.10%	3.30%	0.80%	33.82%	NA
All Japonica	1512	5.60%	43.30%	2.91%	48.15%	NA
Aus	269	45.00%	2.20%	1.86%	50.93%	NA
Indica I	595	93.40%	2.40%	0.34%	3.87%	NA
Indica II	465	58.30%	5.20%	1.29%	35.27%	NA
Indica III	913	50.30%	0.40%	0.33%	48.96%	NA
Indica Intermediate	786	54.50%	6.10%	1.40%	38.04%	NA
Temperate Japonica	767	1.00%	75.90%	4.82%	18.25%	NA
Tropical Japonica	504	12.70%	6.90%	0.60%	79.76%	NA
Japonica Intermediate	241	5.40%	15.80%	1.66%	77.18%	NA
VI/Aromatic	96	46.90%	42.70%	0.00%	10.42%	NA
Intermediate	90	52.20%	18.90%	2.22%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402546694	A -> DEL	N	N	silent_mutation	Average:32.518; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg0402546694	A -> G	LOC_Os04g05120.1	upstream_gene_variant ; 2743.0bp to feature; MODIFIER	silent_mutation	Average:32.518; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg0402546694	A -> G	LOC_Os04g05130.1	intron_variant ; MODIFIER	silent_mutation	Average:32.518; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402546694	NA	2.05E-13	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402546694	NA	6.77E-29	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402546694	NA	2.11E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402546694	NA	1.27E-28	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402546694	NA	3.94E-36	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402546694	NA	2.36E-23	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402546694	NA	2.75E-24	mr1588	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402546694	NA	5.07E-06	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402546694	NA	2.27E-45	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402546694	8.72E-06	NA	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402546694	3.29E-06	1.18E-31	mr1588_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402546694	NA	3.84E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402546694	NA	1.35E-07	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402546694	NA	3.75E-06	mr1892_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251