\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402523133:

Variant ID: vg0402523133 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2523133
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.53, C: 0.49, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


CACATGCACACGCCTCCCCAGCATTTCCTTGCATTCAGAAAAACGTAAGTGGGCCGGAACATGAACCGCGCGCGACGACTCGCGATGACGTGGGCTGAAA[G/C]
ACGCGCCAGATCGCTAACACGTCTTCTTTAATTAGGTGTAGCGGAATACCGCATCGCACTCCACATGGGCGTCGCGATCGTGCATCGATGTCGCTTCCCT

Reverse complement sequence

AGGGAAGCGACATCGATGCACGATCGCGACGCCCATGTGGAGTGCGATGCGGTATTCCGCTACACCTAATTAAAGAAGACGTGTTAGCGATCTGGCGCGT[C/G]
TTTCAGCCCACGTCATCGCGAGTCGTCGCGCGCGGTTCATGTTCCGGCCCACTTACGTTTTTCTGAATGCAAGGAAATGCTGGGGAGGCGTGTGCATGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.80% 35.10% 0.49% 2.64% NA
All Indica  2759 81.10% 13.80% 0.80% 4.31% NA
All Japonica  1512 18.90% 81.00% 0.00% 0.07% NA
Aus  269 93.70% 5.90% 0.37% 0.00% NA
Indica I  595 93.80% 6.20% 0.00% 0.00% NA
Indica II  465 92.90% 6.50% 0.22% 0.43% NA
Indica III  913 70.20% 16.10% 1.97% 11.72% NA
Indica Intermediate  786 77.20% 21.10% 0.38% 1.27% NA
Temperate Japonica  767 22.90% 77.10% 0.00% 0.00% NA
Tropical Japonica  504 16.90% 82.90% 0.00% 0.20% NA
Japonica Intermediate  241 10.40% 89.60% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 62.20% 32.20% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402523133 G -> C LOC_Os04g05090.1 downstream_gene_variant ; 362.0bp to feature; MODIFIER silent_mutation Average:93.376; most accessible tissue: Minghui63 root, score: 99.504 N N N N
vg0402523133 G -> C LOC_Os04g05104.1 downstream_gene_variant ; 750.0bp to feature; MODIFIER silent_mutation Average:93.376; most accessible tissue: Minghui63 root, score: 99.504 N N N N
vg0402523133 G -> C LOC_Os04g05090-LOC_Os04g05104 intergenic_region ; MODIFIER silent_mutation Average:93.376; most accessible tissue: Minghui63 root, score: 99.504 N N N N
vg0402523133 G -> DEL N N silent_mutation Average:93.376; most accessible tissue: Minghui63 root, score: 99.504 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0402523133 G C 0.01 0.02 0.01 0.03 0.0 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402523133 NA 9.55E-11 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0402523133 9.04E-06 NA mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 NA 3.30E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 NA 4.75E-09 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 NA 1.85E-07 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 NA 2.76E-08 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 6.32E-06 7.74E-09 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 NA 3.54E-08 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 NA 3.46E-07 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 NA 6.32E-08 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 5.25E-06 3.00E-09 mr1100 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 NA 1.01E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 7.28E-06 8.68E-09 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 NA 3.33E-08 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 1.79E-06 4.63E-08 mr1140 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 NA 8.76E-06 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 NA 1.04E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 1.82E-06 4.89E-09 mr1203 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 NA 1.04E-07 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 7.10E-06 7.19E-08 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 NA 8.00E-07 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 2.00E-06 4.78E-09 mr1618 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 NA 1.07E-08 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 NA 7.99E-07 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 5.92E-06 5.29E-07 mr1888 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402523133 NA 1.83E-07 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251