\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402499668:

Variant ID: vg0402499668 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2499668
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, T: 0.08, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


CACACAAGCTTGCCTGGCAACGCTTGATGCGGGAAATAGAGAGGGTGGCATAGAGTTATTTGCTGATGACCAGAACGATGGAGGGAGGGAACCTAATGGG[G/T]
AATTGATGGTATTTTATTTTAATGCAATAATGTGAAATGTTAGGGCTCAATAATATAGCCATGTACCATGTACATGCTTAATCTATCTGTGAGAGAGCTG

Reverse complement sequence

CAGCTCTCTCACAGATAGATTAAGCATGTACATGGTACATGGCTATATTATTGAGCCCTAACATTTCACATTATTGCATTAAAATAAAATACCATCAATT[C/A]
CCCATTAGGTTCCCTCCCTCCATCGTTCTGGTCATCAGCAAATAACTCTATGCCACCCTCTCTATTTCCCGCATCAAGCGTTGCCAGGCAAGCTTGTGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.50% 21.40% 0.15% 0.00% NA
All Indica  2759 83.90% 16.00% 0.04% 0.00% NA
All Japonica  1512 79.20% 20.70% 0.13% 0.00% NA
Aus  269 43.10% 55.40% 1.49% 0.00% NA
Indica I  595 93.30% 6.70% 0.00% 0.00% NA
Indica II  465 94.00% 5.80% 0.22% 0.00% NA
Indica III  913 73.60% 26.40% 0.00% 0.00% NA
Indica Intermediate  786 83.00% 17.00% 0.00% 0.00% NA
Temperate Japonica  767 98.70% 1.20% 0.13% 0.00% NA
Tropical Japonica  504 52.80% 47.20% 0.00% 0.00% NA
Japonica Intermediate  241 72.20% 27.40% 0.41% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402499668 G -> T LOC_Os04g05060.1 downstream_gene_variant ; 4365.0bp to feature; MODIFIER silent_mutation Average:51.788; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0402499668 G -> T LOC_Os04g05070.1 downstream_gene_variant ; 1957.0bp to feature; MODIFIER silent_mutation Average:51.788; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0402499668 G -> T LOC_Os04g05060-LOC_Os04g05070 intergenic_region ; MODIFIER silent_mutation Average:51.788; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402499668 NA 8.39E-09 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402499668 NA 2.45E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402499668 6.90E-06 NA mr1085 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402499668 NA 1.94E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402499668 NA 1.11E-07 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402499668 NA 4.54E-06 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402499668 NA 4.25E-06 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402499668 NA 2.38E-06 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402499668 NA 1.45E-08 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402499668 NA 1.71E-07 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251