\
| Variant ID: vg0402499668 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2499668 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, T: 0.08, others allele: 0.00, population size: 218. )
CACACAAGCTTGCCTGGCAACGCTTGATGCGGGAAATAGAGAGGGTGGCATAGAGTTATTTGCTGATGACCAGAACGATGGAGGGAGGGAACCTAATGGG[G/T]
AATTGATGGTATTTTATTTTAATGCAATAATGTGAAATGTTAGGGCTCAATAATATAGCCATGTACCATGTACATGCTTAATCTATCTGTGAGAGAGCTG
CAGCTCTCTCACAGATAGATTAAGCATGTACATGGTACATGGCTATATTATTGAGCCCTAACATTTCACATTATTGCATTAAAATAAAATACCATCAATT[C/A]
CCCATTAGGTTCCCTCCCTCCATCGTTCTGGTCATCAGCAAATAACTCTATGCCACCCTCTCTATTTCCCGCATCAAGCGTTGCCAGGCAAGCTTGTGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.50% | 21.40% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 83.90% | 16.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 79.20% | 20.70% | 0.13% | 0.00% | NA |
| Aus | 269 | 43.10% | 55.40% | 1.49% | 0.00% | NA |
| Indica I | 595 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.00% | 5.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 73.60% | 26.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 83.00% | 17.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 1.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 52.80% | 47.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 72.20% | 27.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402499668 | G -> T | LOC_Os04g05060.1 | downstream_gene_variant ; 4365.0bp to feature; MODIFIER | silent_mutation | Average:51.788; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0402499668 | G -> T | LOC_Os04g05070.1 | downstream_gene_variant ; 1957.0bp to feature; MODIFIER | silent_mutation | Average:51.788; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0402499668 | G -> T | LOC_Os04g05060-LOC_Os04g05070 | intergenic_region ; MODIFIER | silent_mutation | Average:51.788; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402499668 | NA | 8.39E-09 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402499668 | NA | 2.45E-07 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402499668 | 6.90E-06 | NA | mr1085 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402499668 | NA | 1.94E-06 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402499668 | NA | 1.11E-07 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402499668 | NA | 4.54E-06 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402499668 | NA | 4.25E-06 | mr1107_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402499668 | NA | 2.38E-06 | mr1408_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402499668 | NA | 1.45E-08 | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402499668 | NA | 1.71E-07 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |