Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402499668:

Variant ID: vg0402499668 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2499668
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, T: 0.08, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

CACACAAGCTTGCCTGGCAACGCTTGATGCGGGAAATAGAGAGGGTGGCATAGAGTTATTTGCTGATGACCAGAACGATGGAGGGAGGGAACCTAATGGG[G/T]
AATTGATGGTATTTTATTTTAATGCAATAATGTGAAATGTTAGGGCTCAATAATATAGCCATGTACCATGTACATGCTTAATCTATCTGTGAGAGAGCTG

Reverse complement sequence

CAGCTCTCTCACAGATAGATTAAGCATGTACATGGTACATGGCTATATTATTGAGCCCTAACATTTCACATTATTGCATTAAAATAAAATACCATCAATT[C/A]
CCCATTAGGTTCCCTCCCTCCATCGTTCTGGTCATCAGCAAATAACTCTATGCCACCCTCTCTATTTCCCGCATCAAGCGTTGCCAGGCAAGCTTGTGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.50%	21.40%	0.15%	0.00%	NA
All Indica	2759	83.90%	16.00%	0.04%	0.00%	NA
All Japonica	1512	79.20%	20.70%	0.13%	0.00%	NA
Aus	269	43.10%	55.40%	1.49%	0.00%	NA
Indica I	595	93.30%	6.70%	0.00%	0.00%	NA
Indica II	465	94.00%	5.80%	0.22%	0.00%	NA
Indica III	913	73.60%	26.40%	0.00%	0.00%	NA
Indica Intermediate	786	83.00%	17.00%	0.00%	0.00%	NA
Temperate Japonica	767	98.70%	1.20%	0.13%	0.00%	NA
Tropical Japonica	504	52.80%	47.20%	0.00%	0.00%	NA
Japonica Intermediate	241	72.20%	27.40%	0.41%	0.00%	NA
VI/Aromatic	96	13.50%	86.50%	0.00%	0.00%	NA
Intermediate	90	74.40%	25.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402499668	G -> T	LOC_Os04g05060.1	downstream_gene_variant ; 4365.0bp to feature; MODIFIER	silent_mutation	Average:51.788; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0402499668	G -> T	LOC_Os04g05070.1	downstream_gene_variant ; 1957.0bp to feature; MODIFIER	silent_mutation	Average:51.788; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0402499668	G -> T	LOC_Os04g05060-LOC_Os04g05070	intergenic_region ; MODIFIER	silent_mutation	Average:51.788; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402499668	NA	8.39E-09	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402499668	NA	2.45E-07	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402499668	6.90E-06	NA	mr1085	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402499668	NA	1.94E-06	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402499668	NA	1.11E-07	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402499668	NA	4.54E-06	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402499668	NA	4.25E-06	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402499668	NA	2.38E-06	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402499668	NA	1.45E-08	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402499668	NA	1.71E-07	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251