\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402479779:

Variant ID: vg0402479779 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2479779
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


GTGATTCAGTCATTCTCCCTGGTTCAGTCCATTCTCACTCCCTTCATCTAGGTCCAGTTTAAACTAGATCTATACGGGTTAAAATGAAACATTTCTAATG[A/G]
GCAAACTTGTTTATTTGACACTGGATATAATAAAATAATGTGTCCCGTATCCCGTAGCTAATTAATATGTTTTCACAAGTATTCTCTAACAAAGACATAT

Reverse complement sequence

ATATGTCTTTGTTAGAGAATACTTGTGAAAACATATTAATTAGCTACGGGATACGGGACACATTATTTTATTATATCCAGTGTCAAATAAACAAGTTTGC[T/C]
CATTAGAAATGTTTCATTTTAACCCGTATAGATCTAGTTTAAACTGGACCTAGATGAAGGGAGTGAGAATGGACTGAACCAGGGAGAATGACTGAATCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.70% 21.70% 0.51% 2.14% NA
All Indica  2759 95.50% 2.40% 0.14% 1.96% NA
All Japonica  1512 36.30% 59.30% 1.32% 3.11% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 94.40% 3.70% 0.00% 1.94% NA
Indica III  913 95.30% 0.80% 0.22% 3.72% NA
Indica Intermediate  786 94.10% 4.20% 0.25% 1.40% NA
Temperate Japonica  767 26.60% 72.20% 0.52% 0.65% NA
Tropical Japonica  504 52.00% 42.70% 3.17% 2.18% NA
Japonica Intermediate  241 34.40% 52.70% 0.00% 12.86% NA
VI/Aromatic  96 59.40% 40.60% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402479779 A -> DEL N N silent_mutation Average:63.972; most accessible tissue: Zhenshan97 flower, score: 83.709 N N N N
vg0402479779 A -> G LOC_Os04g05050.1 upstream_gene_variant ; 754.0bp to feature; MODIFIER silent_mutation Average:63.972; most accessible tissue: Zhenshan97 flower, score: 83.709 N N N N
vg0402479779 A -> G LOC_Os04g05050.2 upstream_gene_variant ; 3319.0bp to feature; MODIFIER silent_mutation Average:63.972; most accessible tissue: Zhenshan97 flower, score: 83.709 N N N N
vg0402479779 A -> G LOC_Os04g05040-LOC_Os04g05050 intergenic_region ; MODIFIER silent_mutation Average:63.972; most accessible tissue: Zhenshan97 flower, score: 83.709 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402479779 1.23E-06 NA mr1415 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402479779 1.23E-06 NA mr1567 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402479779 3.57E-06 NA mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402479779 NA 2.61E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402479779 NA 6.33E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251