\
| Variant ID: vg0402471059 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2471059 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTGGTATTAATGTATGATAAATTGAGTTTTAATTATTAAAACTTAAAAAAATAGATTAATATGATATTTTAGAGCAACTTTCATATAGAAAATTTTCGCA[C/T]
GAAATGCACCGTTTAACAGTTTGAAAAGCGTGCCACGAAAATCTTAATCTTCATTCAACTCTTGTTGGAGAAAAGAATGAGACACATATATGATTGATAT
ATATCAATCATATATGTGTCTCATTCTTTTCTCCAACAAGAGTTGAATGAAGATTAAGATTTTCGTGGCACGCTTTTCAAACTGTTAAACGGTGCATTTC[G/A]
TGCGAAAATTTTCTATATGAAAGTTGCTCTAAAATATCATATTAATCTATTTTTTTAAGTTTTAATAATTAAAACTCAATTTATCATACATTAATACCAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.90% | 7.80% | 0.13% | 1.23% | NA |
| All Indica | 2759 | 90.30% | 7.40% | 0.22% | 2.10% | NA |
| All Japonica | 1512 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 0.90% | 0.00% | 1.94% | NA |
| Indica III | 913 | 81.30% | 14.50% | 0.44% | 3.83% | NA |
| Indica Intermediate | 786 | 90.10% | 7.90% | 0.25% | 1.78% | NA |
| Temperate Japonica | 767 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 84.10% | 15.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 76.80% | 23.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402471059 | C -> DEL | N | N | silent_mutation | Average:41.845; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| vg0402471059 | C -> T | LOC_Os04g05040-LOC_Os04g05050 | intergenic_region ; MODIFIER | silent_mutation | Average:41.845; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402471059 | NA | 2.96E-06 | mr1380 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402471059 | NA | 3.76E-06 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402471059 | 2.12E-06 | 1.50E-08 | mr1561 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402471059 | NA | 1.88E-10 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402471059 | NA | 8.16E-06 | mr1971 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402471059 | NA | 2.38E-06 | mr1181_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402471059 | NA | 4.07E-07 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402471059 | NA | 1.91E-07 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402471059 | NA | 6.60E-06 | mr1642_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402471059 | NA | 6.88E-09 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402471059 | NA | 6.39E-07 | mr1676_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402471059 | NA | 1.09E-06 | mr1708_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402471059 | 2.11E-06 | 1.62E-16 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402471059 | NA | 1.66E-06 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |