\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402465230:

Variant ID: vg0402465230 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 2465230
Reference Allele: AAlternative Allele: G,AG,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAGTCAAACGTTGTGCGAAAACTATATTGAGGCATCACGACGACGTCGACTTTTTTCTTTTTTTCGTTCAACTCCTCGATCTCTTCTCTTAAAAAAAAA[A/G,AG,T]
GAAAAAAAGTCGAACAGTAAAAGTGAAACTCCTTGACCGCACCGACCAAAGTCCAAACCGATCGATGGGTTTGACTCCACTCGCGCCATGCATGAATCAT

Reverse complement sequence

ATGATTCATGCATGGCGCGAGTGGAGTCAAACCCATCGATCGGTTTGGACTTTGGTCGGTGCGGTCAAGGAGTTTCACTTTTACTGTTCGACTTTTTTTC[T/C,CT,A]
TTTTTTTTTAAGAGAAGAGATCGAGGAGTTGAACGAAAAAAAGAAAAAAGTCGACGTCGTCGTGATGCCTCAATATAGTTTTCGCACAACGTTTGACTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.90% 13.60% 11.64% 1.71% AG: 0.06%; T: 0.02%
All Indica  2759 72.60% 11.70% 12.72% 2.86% AG: 0.11%; T: 0.04%
All Japonica  1512 78.00% 19.90% 2.12% 0.00% NA
Aus  269 57.20% 0.40% 42.01% 0.37% NA
Indica I  595 68.70% 4.00% 22.35% 4.87% NA
Indica II  465 65.20% 13.50% 18.06% 3.23% NA
Indica III  913 78.90% 13.00% 6.13% 1.75% AG: 0.11%; T: 0.11%
Indica Intermediate  786 72.60% 14.80% 9.92% 2.42% AG: 0.25%
Temperate Japonica  767 97.10% 2.90% 0.00% 0.00% NA
Tropical Japonica  504 60.70% 33.70% 5.56% 0.00% NA
Japonica Intermediate  241 53.10% 45.20% 1.66% 0.00% NA
VI/Aromatic  96 46.90% 4.20% 48.96% 0.00% NA
Intermediate  90 73.30% 17.80% 7.78% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402465230 A -> DEL N N silent_mutation Average:56.553; most accessible tissue: Zhenshan97 flower, score: 72.863 N N N N
vg0402465230 A -> G LOC_Os04g05040-LOC_Os04g05050 intergenic_region ; MODIFIER silent_mutation Average:56.553; most accessible tissue: Zhenshan97 flower, score: 72.863 N N N N
vg0402465230 A -> AG LOC_Os04g05040-LOC_Os04g05050 intergenic_region ; MODIFIER silent_mutation Average:56.553; most accessible tissue: Zhenshan97 flower, score: 72.863 N N N N
vg0402465230 A -> T LOC_Os04g05040-LOC_Os04g05050 intergenic_region ; MODIFIER silent_mutation Average:56.553; most accessible tissue: Zhenshan97 flower, score: 72.863 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402465230 NA 3.37E-06 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402465230 NA 4.28E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402465230 NA 5.31E-11 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402465230 2.75E-09 NA mr1798_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402465230 7.80E-07 NA mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251