\
| Variant ID: vg0402465230 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 2465230 |
| Reference Allele: A | Alternative Allele: G,AG,T |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CCAGTCAAACGTTGTGCGAAAACTATATTGAGGCATCACGACGACGTCGACTTTTTTCTTTTTTTCGTTCAACTCCTCGATCTCTTCTCTTAAAAAAAAA[A/G,AG,T]
GAAAAAAAGTCGAACAGTAAAAGTGAAACTCCTTGACCGCACCGACCAAAGTCCAAACCGATCGATGGGTTTGACTCCACTCGCGCCATGCATGAATCAT
ATGATTCATGCATGGCGCGAGTGGAGTCAAACCCATCGATCGGTTTGGACTTTGGTCGGTGCGGTCAAGGAGTTTCACTTTTACTGTTCGACTTTTTTTC[T/C,CT,A]
TTTTTTTTTAAGAGAAGAGATCGAGGAGTTGAACGAAAAAAAGAAAAAAGTCGACGTCGTCGTGATGCCTCAATATAGTTTTCGCACAACGTTTGACTGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.90% | 13.60% | 11.64% | 1.71% | AG: 0.06%; T: 0.02% |
| All Indica | 2759 | 72.60% | 11.70% | 12.72% | 2.86% | AG: 0.11%; T: 0.04% |
| All Japonica | 1512 | 78.00% | 19.90% | 2.12% | 0.00% | NA |
| Aus | 269 | 57.20% | 0.40% | 42.01% | 0.37% | NA |
| Indica I | 595 | 68.70% | 4.00% | 22.35% | 4.87% | NA |
| Indica II | 465 | 65.20% | 13.50% | 18.06% | 3.23% | NA |
| Indica III | 913 | 78.90% | 13.00% | 6.13% | 1.75% | AG: 0.11%; T: 0.11% |
| Indica Intermediate | 786 | 72.60% | 14.80% | 9.92% | 2.42% | AG: 0.25% |
| Temperate Japonica | 767 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 60.70% | 33.70% | 5.56% | 0.00% | NA |
| Japonica Intermediate | 241 | 53.10% | 45.20% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 46.90% | 4.20% | 48.96% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 17.80% | 7.78% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402465230 | A -> DEL | N | N | silent_mutation | Average:56.553; most accessible tissue: Zhenshan97 flower, score: 72.863 | N | N | N | N |
| vg0402465230 | A -> G | LOC_Os04g05040-LOC_Os04g05050 | intergenic_region ; MODIFIER | silent_mutation | Average:56.553; most accessible tissue: Zhenshan97 flower, score: 72.863 | N | N | N | N |
| vg0402465230 | A -> AG | LOC_Os04g05040-LOC_Os04g05050 | intergenic_region ; MODIFIER | silent_mutation | Average:56.553; most accessible tissue: Zhenshan97 flower, score: 72.863 | N | N | N | N |
| vg0402465230 | A -> T | LOC_Os04g05040-LOC_Os04g05050 | intergenic_region ; MODIFIER | silent_mutation | Average:56.553; most accessible tissue: Zhenshan97 flower, score: 72.863 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402465230 | NA | 3.37E-06 | mr1224_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402465230 | NA | 4.28E-06 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402465230 | NA | 5.31E-11 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402465230 | 2.75E-09 | NA | mr1798_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402465230 | 7.80E-07 | NA | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |