\
| Variant ID: vg0402462870 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2462870 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GACGGGTGAATGCTATTTTATTCTTATTATTGTTCAATGTACAATTCACTGTGAGAATTCGCTCGGATATATATTTTTTAGAAAATCATATCAAGTTAGC[A/G]
TGCAAATTTTTTTAAAGAGATTTCTTATTCGACTCCTTCTGTATTTCCAAAAGCGAACAAACTTAAAACCTGACTCAAGTACGGATATGTATTTTCAAAA
TTTTGAAAATACATATCCGTACTTGAGTCAGGTTTTAAGTTTGTTCGCTTTTGGAAATACAGAAGGAGTCGAATAAGAAATCTCTTTAAAAAAATTTGCA[T/C]
GCTAACTTGATATGATTTTCTAAAAAATATATATCCGAGCGAATTCTCACAGTGAATTGTACATTGAACAATAATAAGAATAAAATAGCATTCACCCGTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.00% | 8.80% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 95.90% | 4.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 80.60% | 18.80% | 0.53% | 0.00% | NA |
| Aus | 269 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.20% | 6.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 78.10% | 21.00% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 83.00% | 16.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402462870 | A -> G | LOC_Os04g05040-LOC_Os04g05050 | intergenic_region ; MODIFIER | silent_mutation | Average:19.933; most accessible tissue: Callus, score: 28.052 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402462870 | NA | 9.06E-07 | mr1561 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402462870 | NA | 1.04E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402462870 | NA | 1.81E-10 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402462870 | NA | 9.59E-07 | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402462870 | NA | 1.73E-06 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402462870 | NA | 7.06E-07 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402462870 | NA | 2.32E-06 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402462870 | NA | 3.16E-06 | mr1638_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402462870 | NA | 7.46E-07 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402462870 | NA | 7.38E-06 | mr1708_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402462870 | NA | 4.54E-06 | mr1729_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402462870 | NA | 3.76E-06 | mr1739_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402462870 | NA | 2.77E-07 | mr1751_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402462870 | 9.71E-08 | NA | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402462870 | 9.07E-06 | 2.82E-10 | mr1757_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402462870 | NA | 1.04E-07 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402462870 | NA | 2.65E-14 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402462870 | NA | 6.96E-08 | mr1973_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |