Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402461715:

Variant ID: vg0402461715 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2461715
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTCTCACATTGCATATATTGGATGGTAAGATCAATATATGCATGGAGAGCGACTTTATGCCAAACTCCAAGCACACGTAGTACTACATATGCATGCAA[C/T]
ACACGACAAGAGAGAGCAGCTACTACCTGCCGTTGGATGATCGCGGACTTAGGGCACCCAACAGAAAATCGGAGCTGAAATAGTAGTGATTGCATCCACA

Reverse complement sequence

TGTGGATGCAATCACTACTATTTCAGCTCCGATTTTCTGTTGGGTGCCCTAAGTCCGCGATCATCCAACGGCAGGTAGTAGCTGCTCTCTCTTGTCGTGT[G/A]
TTGCATGCATATGTAGTACTACGTGTGCTTGGAGTTTGGCATAAAGTCGCTCTCCATGCATATATTGATCTTACCATCCAATATATGCAATGTGAGACCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.90% 40.80% 0.25% 0.00% NA
All Indica  2759 34.90% 64.70% 0.36% 0.00% NA
All Japonica  1512 92.90% 7.10% 0.07% 0.00% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 8.60% 91.40% 0.00% 0.00% NA
Indica II  465 18.70% 80.90% 0.43% 0.00% NA
Indica III  913 54.10% 45.30% 0.55% 0.00% NA
Indica Intermediate  786 42.20% 57.40% 0.38% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 80.60% 19.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.10% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402461715 C -> T LOC_Os04g05040-LOC_Os04g05050 intergenic_region ; MODIFIER silent_mutation Average:67.298; most accessible tissue: Zhenshan97 flower, score: 96.398 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0402461715 C T -0.09 -0.06 -0.03 -0.06 -0.11 -0.22

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402461715 2.14E-06 2.12E-30 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 NA 1.23E-08 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 NA 4.00E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 NA 1.38E-09 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 NA 1.99E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 NA 1.18E-09 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 NA 6.71E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 NA 1.54E-08 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 NA 1.98E-08 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 NA 5.07E-15 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 NA 1.13E-06 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 NA 1.65E-07 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 NA 6.42E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 1.58E-10 1.14E-54 mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 NA 1.73E-09 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 NA 3.58E-07 mr1798 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 1.81E-06 7.14E-06 mr1835 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 NA 5.10E-08 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 3.13E-06 NA mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 NA 1.98E-07 mr1037_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 NA 3.79E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 NA 1.76E-19 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 NA 4.91E-26 mr1244_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 NA 1.10E-16 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 5.49E-16 4.46E-75 mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 7.32E-08 1.67E-15 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402461715 5.16E-08 2.57E-11 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251