\
| Variant ID: vg0402458498 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2458498 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.53, C: 0.47, others allele: 0.00, population size: 105. )
ACTTGCGATAGTTTTTTAGCAATTCCCTTTTTTTATCCACCCTTAGCCATGTACCTAGGTTTCTTTTATTAATAACATAAAATAAAATATATCAACTGTA[A/C]
CTTATAATTTTGCAAATATATGGACCAATGCCCATCACTAGCTCGTGGAAAATAAACGAAAAAGTTCAAAGGTGACAAGACATGCAATTATTGAAAAACA
TGTTTTTCAATAATTGCATGTCTTGTCACCTTTGAACTTTTTCGTTTATTTTCCACGAGCTAGTGATGGGCATTGGTCCATATATTTGCAAAATTATAAG[T/G]
TACAGTTGATATATTTTATTTTATGTTATTAATAAAAGAAACCTAGGTACATGGCTAAGGGTGGATAAAAAAAGGGAATTGCTAAAAAACTATCGCAAGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.70% | 32.80% | 0.55% | 0.00% | NA |
| All Indica | 2759 | 87.90% | 12.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 23.10% | 76.50% | 0.40% | 0.00% | NA |
| Aus | 269 | 94.10% | 5.60% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 77.20% | 22.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.40% | 12.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 4.20% | 95.40% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 43.30% | 56.30% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 41.50% | 58.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 67.70% | 15.60% | 16.67% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 34.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402458498 | A -> C | LOC_Os04g05040-LOC_Os04g05050 | intergenic_region ; MODIFIER | silent_mutation | Average:47.391; most accessible tissue: Callus, score: 76.934 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402458498 | NA | 3.91E-14 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402458498 | NA | 9.30E-07 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402458498 | NA | 1.18E-11 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402458498 | NA | 4.30E-14 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402458498 | NA | 3.35E-06 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402458498 | NA | 1.06E-08 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402458498 | NA | 1.88E-22 | mr1689 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402458498 | NA | 6.18E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402458498 | NA | 1.57E-06 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402458498 | NA | 3.66E-07 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402458498 | NA | 4.06E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402458498 | NA | 3.75E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402458498 | NA | 5.77E-06 | mr1689_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402458498 | 3.59E-10 | NA | mr1798_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402458498 | 9.17E-07 | 8.54E-10 | mr1798_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402458498 | NA | 1.67E-07 | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402458498 | NA | 1.63E-07 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |