Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402454995:

Variant ID: vg0402454995 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2454995
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.21, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

TGCACATTCCAATACAGTGATGACTACACATCACCGTGCAGCTAGCTACAGGCGCCGTACTACCTGTATATATAAACCAACTCAACCATAAGTCAAAGCT[G/A]
AAACAGACATGTCCGTTTGCACATAAAGCGACCAAATTAACACTTGACTAATCAAGTACTCCTTCCGTTAAAAAAAATCAACTAAACATACTCATACTCA

Reverse complement sequence

TGAGTATGAGTATGTTTAGTTGATTTTTTTTAACGGAAGGAGTACTTGATTAGTCAAGTGTTAATTTGGTCGCTTTATGTGCAAACGGACATGTCTGTTT[C/T]
AGCTTTGACTTATGGTTGAGTTGGTTTATATATACAGGTAGTACGGCGCCTGTAGCTAGCTGCACGGTGATGTGTAGTCATCACTGTATTGGAATGTGCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.00%	37.70%	0.32%	0.00%	NA
All Indica	2759	57.20%	42.40%	0.40%	0.00%	NA
All Japonica	1512	63.40%	36.40%	0.20%	0.00%	NA
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	58.50%	41.20%	0.34%	0.00%	NA
Indica II	465	68.20%	30.30%	1.51%	0.00%	NA
Indica III	913	47.30%	52.60%	0.11%	0.00%	NA
Indica Intermediate	786	61.10%	38.80%	0.13%	0.00%	NA
Temperate Japonica	767	93.90%	6.00%	0.13%	0.00%	NA
Tropical Japonica	504	28.60%	71.40%	0.00%	0.00%	NA
Japonica Intermediate	241	39.00%	60.20%	0.83%	0.00%	NA
VI/Aromatic	96	74.00%	25.00%	1.04%	0.00%	NA
Intermediate	90	73.30%	26.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402454995	G -> A	LOC_Os04g05040.1	upstream_gene_variant ; 3971.0bp to feature; MODIFIER	silent_mutation	Average:64.99; most accessible tissue: Callus, score: 99.052	N	N	N	N
vg0402454995	G -> A	LOC_Os04g05040-LOC_Os04g05050	intergenic_region ; MODIFIER	silent_mutation	Average:64.99; most accessible tissue: Callus, score: 99.052	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402454995	NA	6.39E-08	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402454995	NA	1.27E-06	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402454995	NA	6.74E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402454995	NA	1.29E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402454995	NA	6.07E-06	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402454995	NA	9.80E-09	mr1454_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402454995	1.69E-06	NA	mr1798_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402454995	2.40E-09	6.75E-11	mr1798_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402454995	NA	3.45E-08	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251