Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0402448500:

Variant ID: vg0402448500 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2448500
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.07, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

GTAGTATGCACTAAAAAATAAACTCAATTCAATAAAGTTAATTTTGTCCTTCATTACATTGGAATCAGAATACCATATATTGCTATAGAAATTATGCTGC[A/G]
TTCTTTTCCACAACTTCAAACTACAACTTTCTCGCTTTCTATTATCACGCTTCCCGAATTGTTAAATGGTGTGTTTTATGGGAAAAAATAATATAAAAGT

Reverse complement sequence

ACTTTTATATTATTTTTTCCCATAAAACACACCATTTAACAATTCGGGAAGCGTGATAATAGAAAGCGAGAAAGTTGTAGTTTGAAGTTGTGGAAAAGAA[T/C]
GCAGCATAATTTCTATAGCAATATATGGTATTCTGATTCCAATGTAATGAAGGACAAAATTAACTTTATTGAATTGAGTTTATTTTTTAGTGCATACTAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.20%	16.70%	0.11%	0.00%	NA
All Indica	2759	92.50%	7.40%	0.07%	0.00%	NA
All Japonica	1512	62.80%	37.10%	0.13%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	96.30%	3.70%	0.00%	0.00%	NA
Indica III	913	85.40%	14.60%	0.00%	0.00%	NA
Indica Intermediate	786	93.30%	6.50%	0.25%	0.00%	NA
Temperate Japonica	767	57.00%	42.80%	0.26%	0.00%	NA
Tropical Japonica	504	69.00%	31.00%	0.00%	0.00%	NA
Japonica Intermediate	241	68.00%	32.00%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	81.10%	17.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402448500	A -> G	LOC_Os04g05030.1	downstream_gene_variant ; 712.0bp to feature; MODIFIER	silent_mutation	Average:58.928; most accessible tissue: Callus, score: 86.599	N	N	N	N
vg0402448500	A -> G	LOC_Os04g05040.1	downstream_gene_variant ; 351.0bp to feature; MODIFIER	silent_mutation	Average:58.928; most accessible tissue: Callus, score: 86.599	N	N	N	N
vg0402448500	A -> G	LOC_Os04g05030-LOC_Os04g05040	intergenic_region ; MODIFIER	silent_mutation	Average:58.928; most accessible tissue: Callus, score: 86.599	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402448500	NA	3.05E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402448500	4.13E-08	NA	mr1798_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251