\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402448500:

Variant ID: vg0402448500 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2448500
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.07, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GTAGTATGCACTAAAAAATAAACTCAATTCAATAAAGTTAATTTTGTCCTTCATTACATTGGAATCAGAATACCATATATTGCTATAGAAATTATGCTGC[A/G]
TTCTTTTCCACAACTTCAAACTACAACTTTCTCGCTTTCTATTATCACGCTTCCCGAATTGTTAAATGGTGTGTTTTATGGGAAAAAATAATATAAAAGT

Reverse complement sequence

ACTTTTATATTATTTTTTCCCATAAAACACACCATTTAACAATTCGGGAAGCGTGATAATAGAAAGCGAGAAAGTTGTAGTTTGAAGTTGTGGAAAAGAA[T/C]
GCAGCATAATTTCTATAGCAATATATGGTATTCTGATTCCAATGTAATGAAGGACAAAATTAACTTTATTGAATTGAGTTTATTTTTTAGTGCATACTAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.20% 16.70% 0.11% 0.00% NA
All Indica  2759 92.50% 7.40% 0.07% 0.00% NA
All Japonica  1512 62.80% 37.10% 0.13% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 85.40% 14.60% 0.00% 0.00% NA
Indica Intermediate  786 93.30% 6.50% 0.25% 0.00% NA
Temperate Japonica  767 57.00% 42.80% 0.26% 0.00% NA
Tropical Japonica  504 69.00% 31.00% 0.00% 0.00% NA
Japonica Intermediate  241 68.00% 32.00% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 81.10% 17.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402448500 A -> G LOC_Os04g05030.1 downstream_gene_variant ; 712.0bp to feature; MODIFIER silent_mutation Average:58.928; most accessible tissue: Callus, score: 86.599 N N N N
vg0402448500 A -> G LOC_Os04g05040.1 downstream_gene_variant ; 351.0bp to feature; MODIFIER silent_mutation Average:58.928; most accessible tissue: Callus, score: 86.599 N N N N
vg0402448500 A -> G LOC_Os04g05030-LOC_Os04g05040 intergenic_region ; MODIFIER silent_mutation Average:58.928; most accessible tissue: Callus, score: 86.599 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402448500 NA 3.05E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402448500 4.13E-08 NA mr1798_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251