\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402432258:

Variant ID: vg0402432258 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2432258
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGCTTGGAAGCTCACGTTCTCTGCTGATTGCGATGGCTTGGATGTCTGCCTCTCCACCAATCAGCCAACAATGCCCTAGAAGATGTGTGAAAGACCATG[T/C]
GTGAGAGAGGTGAGTTAAGTGACAGGTGCAACTTTTAAAATATAGATAGAACGACATTAAGTAAAAGGCTAGCCCTGATTTGATGATGGCACATTGCACA

Reverse complement sequence

TGTGCAATGTGCCATCATCAAATCAGGGCTAGCCTTTTACTTAATGTCGTTCTATCTATATTTTAAAAGTTGCACCTGTCACTTAACTCACCTCTCTCAC[A/G]
CATGGTCTTTCACACATCTTCTAGGGCATTGTTGGCTGATTGGTGGAGAGGCAGACATCCAAGCCATCGCAATCAGCAGAGAACGTGAGCTTCCAAGCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.40% 22.50% 0.11% 0.00% NA
All Indica  2759 81.10% 18.80% 0.11% 0.00% NA
All Japonica  1512 70.20% 29.70% 0.07% 0.00% NA
Aus  269 88.80% 11.20% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 64.10% 35.70% 0.22% 0.00% NA
Indica Intermediate  786 78.90% 21.00% 0.13% 0.00% NA
Temperate Japonica  767 76.00% 24.00% 0.00% 0.00% NA
Tropical Japonica  504 66.10% 33.70% 0.20% 0.00% NA
Japonica Intermediate  241 60.60% 39.40% 0.00% 0.00% NA
VI/Aromatic  96 45.80% 54.20% 0.00% 0.00% NA
Intermediate  90 85.60% 13.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402432258 T -> C LOC_Os04g05010.1 upstream_gene_variant ; 2754.0bp to feature; MODIFIER silent_mutation Average:56.929; most accessible tissue: Callus, score: 85.419 N N N N
vg0402432258 T -> C LOC_Os04g05020.1 downstream_gene_variant ; 3279.0bp to feature; MODIFIER silent_mutation Average:56.929; most accessible tissue: Callus, score: 85.419 N N N N
vg0402432258 T -> C LOC_Os04g05010-LOC_Os04g05020 intergenic_region ; MODIFIER silent_mutation Average:56.929; most accessible tissue: Callus, score: 85.419 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402432258 NA 1.87E-07 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432258 NA 1.65E-09 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432258 NA 1.00E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432258 NA 1.17E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432258 NA 2.05E-09 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432258 NA 4.68E-10 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432258 NA 2.73E-09 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432258 NA 1.93E-08 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432258 NA 1.05E-07 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432258 NA 8.47E-10 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432258 NA 4.69E-09 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432258 NA 3.57E-08 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432258 NA 7.81E-12 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432258 NA 1.36E-08 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432258 NA 4.83E-08 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432258 NA 1.19E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432258 NA 9.39E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432258 NA 1.21E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432258 NA 7.56E-09 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432258 NA 2.63E-10 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432258 9.03E-12 NA mr1798_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432258 NA 3.57E-10 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432258 3.66E-09 1.37E-09 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251