\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402432151:

Variant ID: vg0402432151 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2432151
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, G: 0.31, others allele: 0.00, population size: 35. )

Flanking Sequence (100 bp) in Reference Genome:


TCAATTCTCTCACATTCAGGCCTCCCATCAGTAGGCTGAAAATAAATAAATAATAATCATGTTGGGGTTCAGCAATTTGTTAGCACTTGTTTTTGTCATC[A/G]
ATGCCATTGCTTGGAAGCTCACGTTCTCTGCTGATTGCGATGGCTTGGATGTCTGCCTCTCCACCAATCAGCCAACAATGCCCTAGAAGATGTGTGAAAG

Reverse complement sequence

CTTTCACACATCTTCTAGGGCATTGTTGGCTGATTGGTGGAGAGGCAGACATCCAAGCCATCGCAATCAGCAGAGAACGTGAGCTTCCAAGCAATGGCAT[T/C]
GATGACAAAAACAAGTGCTAACAAATTGCTGAACCCCAACATGATTATTATTTATTTATTTTCAGCCTACTGATGGGAGGCCTGAATGTGAGAGAATTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.20% 30.90% 0.21% 0.72% NA
All Indica  2759 80.10% 19.80% 0.11% 0.07% NA
All Japonica  1512 44.40% 53.90% 0.26% 1.39% NA
Aus  269 87.70% 11.50% 0.74% 0.00% NA
Indica I  595 97.60% 2.40% 0.00% 0.00% NA
Indica II  465 94.40% 5.40% 0.22% 0.00% NA
Indica III  913 63.60% 36.30% 0.11% 0.00% NA
Indica Intermediate  786 77.40% 22.30% 0.13% 0.25% NA
Temperate Japonica  767 32.30% 67.00% 0.26% 0.39% NA
Tropical Japonica  504 60.10% 36.30% 0.20% 3.37% NA
Japonica Intermediate  241 50.20% 49.00% 0.41% 0.41% NA
VI/Aromatic  96 36.50% 52.10% 0.00% 11.46% NA
Intermediate  90 77.80% 21.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402432151 A -> DEL N N silent_mutation Average:48.495; most accessible tissue: Callus, score: 69.804 N N N N
vg0402432151 A -> G LOC_Os04g05010.1 upstream_gene_variant ; 2647.0bp to feature; MODIFIER silent_mutation Average:48.495; most accessible tissue: Callus, score: 69.804 N N N N
vg0402432151 A -> G LOC_Os04g05020.1 downstream_gene_variant ; 3386.0bp to feature; MODIFIER silent_mutation Average:48.495; most accessible tissue: Callus, score: 69.804 N N N N
vg0402432151 A -> G LOC_Os04g05010-LOC_Os04g05020 intergenic_region ; MODIFIER silent_mutation Average:48.495; most accessible tissue: Callus, score: 69.804 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402432151 NA 8.64E-12 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0402432151 NA 1.08E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 NA 2.56E-08 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 NA 1.63E-08 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 NA 4.55E-08 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 NA 2.94E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 NA 6.15E-07 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 NA 1.59E-09 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 NA 3.20E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 NA 5.07E-11 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 NA 9.33E-08 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 NA 8.86E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 NA 6.78E-08 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 NA 2.45E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 NA 7.47E-07 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 NA 6.27E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 NA 3.13E-09 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 NA 1.31E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 NA 3.44E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 3.60E-06 3.60E-06 mr1597_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 NA 3.08E-11 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 NA 1.47E-07 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 2.53E-10 NA mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 NA 3.86E-09 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402432151 8.77E-10 7.59E-13 mr1798_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251