\
| Variant ID: vg0402406368 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2406368 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATACACACAGTGTCTTGGAGTCTGTGCTACAGCTGGCTATAAATCTGTAGCCCGCTGCCCTTATATCTCCTTATTTATCTCTTTAAAATATGTTTGCAG[C/T]
TGGCTTATAGCCTGCTATTGTACCTGCTCTAAAAGGTGCTTCCCCAAGCTAAAAATCGGACAAAGAGAGCCATCATTTCGCTTATGCTTATACTTATAAA
TTTATAAGTATAAGCATAAGCGAAATGATGGCTCTCTTTGTCCGATTTTTAGCTTGGGGAAGCACCTTTTAGAGCAGGTACAATAGCAGGCTATAAGCCA[G/A]
CTGCAAACATATTTTAAAGAGATAAATAAGGAGATATAAGGGCAGCGGGCTACAGATTTATAGCCAGCTGTAGCACAGACTCCAAGACACTGTGTGTATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.00% | 15.90% | 0.04% | 2.05% | NA |
| All Indica | 2759 | 82.90% | 17.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 77.50% | 16.50% | 0.07% | 5.95% | NA |
| Aus | 269 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 69.20% | 30.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 81.30% | 18.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.50% | 2.10% | 0.13% | 3.26% | NA |
| Tropical Japonica | 504 | 53.80% | 35.30% | 0.00% | 10.91% | NA |
| Japonica Intermediate | 241 | 73.00% | 22.80% | 0.00% | 4.15% | NA |
| VI/Aromatic | 96 | 90.60% | 4.20% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 81.10% | 15.60% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402406368 | C -> DEL | N | N | silent_mutation | Average:43.384; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0402406368 | C -> T | LOC_Os04g04970.1 | upstream_gene_variant ; 1657.0bp to feature; MODIFIER | silent_mutation | Average:43.384; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0402406368 | C -> T | LOC_Os04g04950-LOC_Os04g04970 | intergenic_region ; MODIFIER | silent_mutation | Average:43.384; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402406368 | 5.41E-06 | NA | mr1037 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402406368 | 1.81E-06 | 1.26E-12 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402406368 | NA | 1.09E-11 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402406368 | 2.34E-15 | NA | mr1798 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402406368 | 7.15E-12 | 1.48E-19 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402406368 | 8.88E-08 | NA | mr1037_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402406368 | 2.68E-08 | 4.53E-12 | mr1037_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402406368 | NA | 1.40E-07 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402406368 | NA | 6.35E-06 | mr1181_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402406368 | NA | 9.32E-13 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402406368 | 1.23E-32 | NA | mr1798_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402406368 | 3.26E-16 | 2.27E-39 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402406368 | 1.42E-11 | NA | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |