Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402405140:

Variant ID: vg0402405140 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2405140
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, C: 0.30, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:

TATATAGAGTGTCGCATGGGGTATTTGGGCACTAATAAAAAAAACTAATTACAGAATCCGTCAGTAAACCGCGAGACGAATTTATTAAGCCTAGTTAAGC[C/A]
GTTATTAGCAAATGTTTACTGTAGCACCACATTGTTAAATCATGGAGCAATTAGGCTCAAAAGATTCGTCTCGCAAATTAGTCACAATCTGTCCAATTGG

Reverse complement sequence

CCAATTGGACAGATTGTGACTAATTTGCGAGACGAATCTTTTGAGCCTAATTGCTCCATGATTTAACAATGTGGTGCTACAGTAAACATTTGCTAATAAC[G/T]
GCTTAACTAGGCTTAATAAATTCGTCTCGCGGTTTACTGACGGATTCTGTAATTAGTTTTTTTTATTAGTGCCCAAATACCCCATGCGACACTCTATATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.40%	20.30%	0.95%	8.34%	NA
All Indica	2759	95.50%	4.10%	0.22%	0.18%	NA
All Japonica	1512	37.80%	35.30%	2.25%	24.67%	NA
Aus	269	16.40%	82.20%	0.37%	1.12%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	96.80%	2.40%	0.43%	0.43%	NA
Indica III	913	93.30%	6.60%	0.11%	0.00%	NA
Indica Intermediate	786	94.40%	4.80%	0.38%	0.38%	NA
Temperate Japonica	767	11.00%	48.60%	3.39%	37.03%	NA
Tropical Japonica	504	70.80%	16.50%	1.39%	11.31%	NA
Japonica Intermediate	241	54.40%	32.00%	0.41%	13.28%	NA
VI/Aromatic	96	11.50%	82.30%	0.00%	6.25%	NA
Intermediate	90	70.00%	17.80%	4.44%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402405140	C -> DEL	N	N	silent_mutation	Average:44.104; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0402405140	C -> A	LOC_Os04g04970.1	upstream_gene_variant ; 2885.0bp to feature; MODIFIER	silent_mutation	Average:44.104; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0402405140	C -> A	LOC_Os04g04950-LOC_Os04g04970	intergenic_region ; MODIFIER	silent_mutation	Average:44.104; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402405140	NA	1.71E-12	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	2.35E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	4.16E-06	2.25E-06	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	3.19E-17	mr1147	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	7.78E-30	mr1208	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	1.33E-08	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	2.95E-16	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	2.09E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	3.82E-10	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	2.97E-09	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	8.50E-06	mr1520	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	5.11E-09	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	1.69E-14	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	8.95E-06	1.14E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	1.10E-08	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	9.73E-09	mr1717	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	5.73E-14	mr1732	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	2.25E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	6.68E-09	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	1.42E-09	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	5.29E-06	6.57E-09	mr1785	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	3.52E-09	mr1929	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	1.53E-12	mr1147_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	4.74E-08	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	1.13E-09	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	1.07E-14	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402405140	NA	3.15E-06	mr1929_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251