\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402401535:

Variant ID: vg0402401535 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2401535
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


AAATTTGTTGTGTTTGGTTATCACATCAGATATACGGATATACATTTAAAACATTAAATGTGGTCTAATAACAAAACAAATTACAGATTTTACCAGAAAA[T/C]
TACGAGATGAATTTATTAAGCTTAATTAGTCTGTCATTAGCAAATGTTTACTGTAGCACCACATTATCAAATTATGACGCAATTAGACTTAAAAGATTTG

Reverse complement sequence

CAAATCTTTTAAGTCTAATTGCGTCATAATTTGATAATGTGGTGCTACAGTAAACATTTGCTAATGACAGACTAATTAAGCTTAATAAATTCATCTCGTA[A/G]
TTTTCTGGTAAAATCTGTAATTTGTTTTGTTATTAGACCACATTTAATGTTTTAAATGTATATCCGTATATCTGATGTGATAACCAAACACAACAAATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.80% 18.10% 0.06% 0.00% NA
All Indica  2759 95.40% 4.60% 0.00% 0.00% NA
All Japonica  1512 54.20% 45.70% 0.13% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 91.30% 8.70% 0.00% 0.00% NA
Indica Intermediate  786 95.70% 4.30% 0.00% 0.00% NA
Temperate Japonica  767 31.00% 68.70% 0.26% 0.00% NA
Tropical Japonica  504 88.50% 11.50% 0.00% 0.00% NA
Japonica Intermediate  241 56.00% 44.00% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402401535 T -> C LOC_Os04g04950.1 upstream_gene_variant ; 3116.0bp to feature; MODIFIER silent_mutation Average:26.658; most accessible tissue: Callus, score: 70.358 N N N N
vg0402401535 T -> C LOC_Os04g04950-LOC_Os04g04970 intergenic_region ; MODIFIER silent_mutation Average:26.658; most accessible tissue: Callus, score: 70.358 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402401535 3.08E-06 1.79E-06 mr1024 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402401535 NA 3.27E-09 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402401535 NA 5.59E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402401535 NA 7.47E-12 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402401535 NA 9.82E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402401535 NA 3.69E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402401535 NA 3.98E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402401535 NA 6.97E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402401535 NA 1.53E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402401535 NA 3.65E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402401535 NA 2.75E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251