\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402386328:

Variant ID: vg0402386328 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2386328
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGAGGCCCCTGGACCTTTTCGGCTTGTTCTTCACTGGCAGCCACCTCAGAAGTTGTTCCAGTTTGAGGCTCTTCCTCGGCCCCAGTGGTCTGACCTACT[A/G]
GTGGGATTTCTTCATCGTCACCTCCTTTATTTTGGGGGCCACCTTTAGTCGAGGGTTCCTGGCTCTAGGGCCCTTGTTCCGGCTGGTCTTCGGATGACGG

Reverse complement sequence

CCGTCATCCGAAGACCAGCCGGAACAAGGGCCCTAGAGCCAGGAACCCTCGACTAAAGGTGGCCCCCAAAATAAAGGAGGTGACGATGAAGAAATCCCAC[T/C]
AGTAGGTCAGACCACTGGGGCCGAGGAAGAGCCTCAAACTGGAACAACTTCTGAGGTGGCTGCCAGTGAAGAACAAGCCGAAAAGGTCCAGGGGCCTCCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 7.00% 0.36% 1.10% NA
All Indica  2759 88.10% 9.60% 0.43% 1.88% NA
All Japonica  1512 98.10% 1.90% 0.07% 0.00% NA
Aus  269 90.00% 8.60% 1.49% 0.00% NA
Indica I  595 94.60% 5.20% 0.00% 0.17% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 81.30% 13.70% 1.10% 3.94% NA
Indica Intermediate  786 84.40% 13.50% 0.25% 1.91% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 97.40% 2.40% 0.20% 0.00% NA
Japonica Intermediate  241 93.40% 6.60% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402386328 A -> DEL N N silent_mutation Average:45.019; most accessible tissue: Zhenshan97 young leaf, score: 69.723 N N N N
vg0402386328 A -> G LOC_Os04g04940.1 upstream_gene_variant ; 2163.0bp to feature; MODIFIER silent_mutation Average:45.019; most accessible tissue: Zhenshan97 young leaf, score: 69.723 N N N N
vg0402386328 A -> G LOC_Os04g04950.1 downstream_gene_variant ; 3950.0bp to feature; MODIFIER silent_mutation Average:45.019; most accessible tissue: Zhenshan97 young leaf, score: 69.723 N N N N
vg0402386328 A -> G LOC_Os04g04940-LOC_Os04g04950 intergenic_region ; MODIFIER silent_mutation Average:45.019; most accessible tissue: Zhenshan97 young leaf, score: 69.723 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402386328 NA 4.41E-09 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402386328 1.94E-06 NA mr1798 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402386328 4.97E-07 2.99E-14 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402386328 5.96E-07 NA mr1037_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402386328 3.72E-10 6.93E-13 mr1037_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402386328 6.05E-10 NA mr1798_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402386328 1.73E-13 6.81E-31 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251