\
| Variant ID: vg0402386328 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2386328 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AGGAGGCCCCTGGACCTTTTCGGCTTGTTCTTCACTGGCAGCCACCTCAGAAGTTGTTCCAGTTTGAGGCTCTTCCTCGGCCCCAGTGGTCTGACCTACT[A/G]
GTGGGATTTCTTCATCGTCACCTCCTTTATTTTGGGGGCCACCTTTAGTCGAGGGTTCCTGGCTCTAGGGCCCTTGTTCCGGCTGGTCTTCGGATGACGG
CCGTCATCCGAAGACCAGCCGGAACAAGGGCCCTAGAGCCAGGAACCCTCGACTAAAGGTGGCCCCCAAAATAAAGGAGGTGACGATGAAGAAATCCCAC[T/C]
AGTAGGTCAGACCACTGGGGCCGAGGAAGAGCCTCAAACTGGAACAACTTCTGAGGTGGCTGCCAGTGAAGAACAAGCCGAAAAGGTCCAGGGGCCTCCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.50% | 7.00% | 0.36% | 1.10% | NA |
| All Indica | 2759 | 88.10% | 9.60% | 0.43% | 1.88% | NA |
| All Japonica | 1512 | 98.10% | 1.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 90.00% | 8.60% | 1.49% | 0.00% | NA |
| Indica I | 595 | 94.60% | 5.20% | 0.00% | 0.17% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 81.30% | 13.70% | 1.10% | 3.94% | NA |
| Indica Intermediate | 786 | 84.40% | 13.50% | 0.25% | 1.91% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.40% | 2.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402386328 | A -> DEL | N | N | silent_mutation | Average:45.019; most accessible tissue: Zhenshan97 young leaf, score: 69.723 | N | N | N | N |
| vg0402386328 | A -> G | LOC_Os04g04940.1 | upstream_gene_variant ; 2163.0bp to feature; MODIFIER | silent_mutation | Average:45.019; most accessible tissue: Zhenshan97 young leaf, score: 69.723 | N | N | N | N |
| vg0402386328 | A -> G | LOC_Os04g04950.1 | downstream_gene_variant ; 3950.0bp to feature; MODIFIER | silent_mutation | Average:45.019; most accessible tissue: Zhenshan97 young leaf, score: 69.723 | N | N | N | N |
| vg0402386328 | A -> G | LOC_Os04g04940-LOC_Os04g04950 | intergenic_region ; MODIFIER | silent_mutation | Average:45.019; most accessible tissue: Zhenshan97 young leaf, score: 69.723 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402386328 | NA | 4.41E-09 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402386328 | 1.94E-06 | NA | mr1798 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402386328 | 4.97E-07 | 2.99E-14 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402386328 | 5.96E-07 | NA | mr1037_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402386328 | 3.72E-10 | 6.93E-13 | mr1037_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402386328 | 6.05E-10 | NA | mr1798_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402386328 | 1.73E-13 | 6.81E-31 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |