\
| Variant ID: vg0402384313 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2384313 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.01, others allele: 0.00, population size: 68. )
TGACCTTCCTCGGTAGCATTCGCTCTCAGTGGTTTCGCTCGGAGGTCCCCACGGTCGGCACCAGCTGTTGTCGAAACGATAACCGCATACGTCGAAAGAC[A/G]
TGGTTACTCAACAGTGGTTGGAAAGAAATGAAGTGTATTAAGTTTTAGAGTTTTTTACTCCGGATCCCCCATTACATGGCCCTAGGGGACTATTTATAGC
GCTATAAATAGTCCCCTAGGGCCATGTAATGGGGGATCCGGAGTAAAAAACTCTAAAACTTAATACACTTCATTTCTTTCCAACCACTGTTGAGTAACCA[T/C]
GTCTTTCGACGTATGCGGTTATCGTTTCGACAACAGCTGGTGCCGACCGTGGGGACCTCCGAGCGAAACCACTGAGAGCGAATGCTACCGAGGAAGGTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 16.40% | 12.50% | 24.74% | 46.40% | NA |
| All Indica | 2759 | 7.10% | 2.80% | 27.55% | 62.56% | NA |
| All Japonica | 1512 | 31.90% | 33.10% | 10.45% | 24.60% | NA |
| Aus | 269 | 14.10% | 1.10% | 65.80% | 18.96% | NA |
| Indica I | 595 | 4.70% | 0.20% | 21.51% | 73.61% | NA |
| Indica II | 465 | 6.50% | 4.10% | 17.42% | 72.04% | NA |
| Indica III | 913 | 8.70% | 2.60% | 33.73% | 54.98% | NA |
| Indica Intermediate | 786 | 7.50% | 4.20% | 30.92% | 57.38% | NA |
| Temperate Japonica | 767 | 29.10% | 59.10% | 8.60% | 3.26% | NA |
| Tropical Japonica | 504 | 32.50% | 2.60% | 15.87% | 49.01% | NA |
| Japonica Intermediate | 241 | 39.40% | 14.10% | 4.98% | 41.49% | NA |
| VI/Aromatic | 96 | 36.50% | 0.00% | 43.75% | 19.79% | NA |
| Intermediate | 90 | 25.60% | 11.10% | 35.56% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402384313 | A -> DEL | N | N | silent_mutation | Average:19.627; most accessible tissue: Minghui63 young leaf, score: 26.082 | N | N | N | N |
| vg0402384313 | A -> G | LOC_Os04g04940.1 | upstream_gene_variant ; 148.0bp to feature; MODIFIER | silent_mutation | Average:19.627; most accessible tissue: Minghui63 young leaf, score: 26.082 | N | N | N | N |
| vg0402384313 | A -> G | LOC_Os04g04940-LOC_Os04g04950 | intergenic_region ; MODIFIER | silent_mutation | Average:19.627; most accessible tissue: Minghui63 young leaf, score: 26.082 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402384313 | 5.41E-07 | NA | mr1037 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402384313 | 2.37E-06 | 3.38E-13 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402384313 | 1.99E-10 | NA | mr1798 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402384313 | 2.38E-11 | 4.45E-22 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402384313 | 4.98E-08 | NA | mr1037_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402384313 | 2.01E-10 | 1.28E-13 | mr1037_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402384313 | NA | 5.34E-07 | mr1521_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402384313 | NA | 2.12E-06 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402384313 | 2.19E-06 | 2.19E-06 | mr1597_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402384313 | NA | 7.35E-06 | mr1693_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402384313 | 3.96E-22 | NA | mr1798_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402384313 | 3.82E-24 | 1.08E-49 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402384313 | 7.86E-07 | 2.34E-08 | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |