\
| Variant ID: vg0402381225 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2381225 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 86. )
GGGGCGAATACCAGTGTCCATTCAGCTACGAAGTCAGCTAGCACTTGAGACTTGATAGCAGTGCGTGCAACAAAATGCAAGTCGAACGGGGATAACTCTG[C/T]
CGCCCACTTGCTGAGCCGGCCGGTGACTTCCTTGCCTCGGAGTATTTCGCCCAAAGGGTACTGTGGTGGCACTATGACTTTGTGGGCCTGGAAGTAGTGC
GCACTACTTCCAGGCCCACAAAGTCATAGTGCCACCACAGTACCCTTTGGGCGAAATACTCCGAGGCAAGGAAGTCACCGGCCGGCTCAGCAAGTGGGCG[G/A]
CAGAGTTATCCCCGTTCGACTTGCATTTTGTTGCACGCACTGCTATCAAGTCTCAAGTGCTAGCTGACTTCGTAGCTGAATGGACACTGGTATTCGCCCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.80% | 23.90% | 11.98% | 6.39% | NA |
| All Indica | 2759 | 48.00% | 34.90% | 15.48% | 1.63% | NA |
| All Japonica | 1512 | 78.20% | 1.70% | 5.82% | 14.29% | NA |
| Aus | 269 | 45.40% | 41.60% | 9.29% | 3.72% | NA |
| Indica I | 595 | 58.00% | 18.20% | 22.52% | 1.34% | NA |
| Indica II | 465 | 41.90% | 40.90% | 16.13% | 1.08% | NA |
| Indica III | 913 | 46.20% | 42.50% | 9.64% | 1.64% | NA |
| Indica Intermediate | 786 | 46.10% | 35.20% | 16.54% | 2.16% | NA |
| Temperate Japonica | 767 | 91.70% | 0.30% | 3.65% | 4.43% | NA |
| Tropical Japonica | 504 | 63.10% | 3.20% | 9.72% | 24.01% | NA |
| Japonica Intermediate | 241 | 66.80% | 3.30% | 4.56% | 25.31% | NA |
| VI/Aromatic | 96 | 54.20% | 4.20% | 12.50% | 29.17% | NA |
| Intermediate | 90 | 55.60% | 25.60% | 15.56% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402381225 | C -> DEL | LOC_Os04g04940.1 | N | frameshift_variant | Average:19.753; most accessible tissue: Callus, score: 28.651 | N | N | N | N |
| vg0402381225 | C -> T | LOC_Os04g04940.1 | missense_variant ; p.Ala760Thr; MODERATE | nonsynonymous_codon ; A760T | Average:19.753; most accessible tissue: Callus, score: 28.651 | benign |
0.577 |
TOLERATED | 0.10 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402381225 | NA | 3.81E-07 | mr1317 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402381225 | NA | 2.41E-07 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402381225 | NA | 2.73E-06 | mr1414 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402381225 | NA | 1.77E-06 | mr1608 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402381225 | NA | 4.46E-07 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402381225 | NA | 1.32E-14 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402381225 | NA | 7.45E-12 | mr1846 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402381225 | NA | 1.18E-06 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402381225 | NA | 3.69E-07 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402381225 | NA | 1.75E-07 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402381225 | NA | 3.86E-06 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402381225 | NA | 2.29E-11 | mr1830_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402381225 | NA | 3.69E-08 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402381225 | NA | 3.01E-22 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402381225 | NA | 2.47E-18 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |