| Variant ID: vg0402378441 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2378441 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAAATCGTGCATTCGGCCCCCTTTTGGGAGTTGGCGAGGTCAAAACGAGAAATTTGTGGCATTGAAGGGTCTGCCGAAGGTGCGATGTCCATTTCGGCCC[G/A]
TTTATCACGAAATGGAGATAAACGGTCGCAGCTATAAGGTTTTTAAGGTTGCCGGCTGGCTGCGGGCGCACCCCGGGCGAACCTTAGAAGACTACAACCT
AGGTTGTAGTCTTCTAAGGTTCGCCCGGGGTGCGCCCGCAGCCAGCCGGCAACCTTAAAAACCTTATAGCTGCGACCGTTTATCTCCATTTCGTGATAAA[C/T]
GGGCCGAAATGGACATCGCACCTTCGGCAGACCCTTCAATGCCACAAATTTCTCGTTTTGACCTCGCCAACTCCCAAAAGGGGGCCGAATGCACGATTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.60% | 1.20% | 3.94% | 66.29% | NA |
| All Indica | 2759 | 7.10% | 1.10% | 5.33% | 86.52% | NA |
| All Japonica | 1512 | 71.60% | 0.10% | 1.06% | 27.25% | NA |
| Aus | 269 | 3.00% | 8.90% | 7.43% | 80.67% | NA |
| Indica I | 595 | 8.20% | 0.30% | 3.53% | 87.90% | NA |
| Indica II | 465 | 3.40% | 1.30% | 6.45% | 88.82% | NA |
| Indica III | 913 | 6.60% | 1.10% | 5.48% | 86.86% | NA |
| Indica Intermediate | 786 | 8.90% | 1.50% | 5.85% | 83.72% | NA |
| Temperate Japonica | 767 | 90.00% | 0.00% | 0.26% | 9.78% | NA |
| Tropical Japonica | 504 | 47.40% | 0.20% | 1.98% | 50.40% | NA |
| Japonica Intermediate | 241 | 63.90% | 0.00% | 1.66% | 34.44% | NA |
| VI/Aromatic | 96 | 33.30% | 0.00% | 1.04% | 65.62% | NA |
| Intermediate | 90 | 36.70% | 1.10% | 2.22% | 60.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402378441 | G -> DEL | N | N | silent_mutation | Average:12.003; most accessible tissue: Callus, score: 38.065 | N | N | N | N |
| vg0402378441 | G -> A | LOC_Os04g04930.1 | downstream_gene_variant ; 643.0bp to feature; MODIFIER | silent_mutation | Average:12.003; most accessible tissue: Callus, score: 38.065 | N | N | N | N |
| vg0402378441 | G -> A | LOC_Os04g04940.1 | downstream_gene_variant ; 1024.0bp to feature; MODIFIER | silent_mutation | Average:12.003; most accessible tissue: Callus, score: 38.065 | N | N | N | N |
| vg0402378441 | G -> A | LOC_Os04g04930-LOC_Os04g04940 | intergenic_region ; MODIFIER | silent_mutation | Average:12.003; most accessible tissue: Callus, score: 38.065 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402378441 | NA | 1.95E-13 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402378441 | NA | 1.84E-07 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402378441 | NA | 6.35E-11 | mr1830_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402378441 | NA | 3.87E-07 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402378441 | NA | 1.82E-23 | mr1846_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402378441 | NA | 1.95E-14 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |