Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402378307:

Variant ID: vg0402378307 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2378307
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.03, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

TTGATGGTCGAAGTCTTTGGCGTATTATTATTTTGCTCATTTCGCATTATGCCATACCTTTCTTTTCTTTCGCCTATTCTTATTATGTAAATTGTGTTTT[T/G]
CCCTTTCTGCACTGTCTACCAGGGTGTTAGCCGAAAATCGTGCATTCGGCCCCCTTTTGGGAGTTGGCGAGGTCAAAACGAGAAATTTGTGGCATTGAAG

Reverse complement sequence

CTTCAATGCCACAAATTTCTCGTTTTGACCTCGCCAACTCCCAAAAGGGGGCCGAATGCACGATTTTCGGCTAACACCCTGGTAGACAGTGCAGAAAGGG[A/C]
AAAACACAATTTACATAATAAGAATAGGCGAAAGAAAAGAAAGGTATGGCATAATGCGAAATGAGCAAAATAATAATACGCCAAAGACTTCGACCATCAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	15.60%	14.50%	11.72%	58.15%	NA
All Indica	2759	7.20%	3.80%	17.69%	71.37%	NA
All Japonica	1512	30.40%	37.10%	1.26%	31.28%	NA
Aus	269	12.30%	1.90%	11.90%	73.98%	NA
Indica I	595	2.40%	6.60%	8.24%	82.86%	NA
Indica II	465	5.80%	2.20%	21.29%	70.75%	NA
Indica III	913	9.50%	1.00%	23.22%	66.27%	NA
Indica Intermediate	786	8.90%	5.90%	16.28%	68.96%	NA
Temperate Japonica	767	27.80%	61.70%	0.26%	10.30%	NA
Tropical Japonica	504	30.60%	7.30%	2.98%	59.13%	NA
Japonica Intermediate	241	38.20%	21.20%	0.83%	39.83%	NA
VI/Aromatic	96	29.20%	3.10%	2.08%	65.62%	NA
Intermediate	90	22.20%	14.40%	14.44%	48.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402378307	T -> DEL	N	N	silent_mutation	Average:10.745; most accessible tissue: Callus, score: 20.498	N	N	N	N
vg0402378307	T -> G	LOC_Os04g04930.1	downstream_gene_variant ; 509.0bp to feature; MODIFIER	silent_mutation	Average:10.745; most accessible tissue: Callus, score: 20.498	N	N	N	N
vg0402378307	T -> G	LOC_Os04g04940.1	downstream_gene_variant ; 1158.0bp to feature; MODIFIER	silent_mutation	Average:10.745; most accessible tissue: Callus, score: 20.498	N	N	N	N
vg0402378307	T -> G	LOC_Os04g04930-LOC_Os04g04940	intergenic_region ; MODIFIER	silent_mutation	Average:10.745; most accessible tissue: Callus, score: 20.498	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402378307	NA	1.50E-07	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	3.28E-08	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	4.37E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	1.10E-06	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	1.70E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	6.14E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	7.81E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	4.97E-06	4.97E-06	mr1147_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	3.28E-06	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	1.87E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	1.04E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	4.92E-09	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	9.09E-09	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	1.11E-07	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	4.98E-07	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	1.23E-10	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	2.71E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	1.69E-06	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	1.11E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	2.98E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	5.73E-07	mr1668_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	1.10E-07	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	5.01E-06	mr1763_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	5.22E-09	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	3.99E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	3.01E-06	2.10E-10	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307	NA	2.45E-10	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251