\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402378307:

Variant ID: vg0402378307 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2378307
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.03, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


TTGATGGTCGAAGTCTTTGGCGTATTATTATTTTGCTCATTTCGCATTATGCCATACCTTTCTTTTCTTTCGCCTATTCTTATTATGTAAATTGTGTTTT[T/G]
CCCTTTCTGCACTGTCTACCAGGGTGTTAGCCGAAAATCGTGCATTCGGCCCCCTTTTGGGAGTTGGCGAGGTCAAAACGAGAAATTTGTGGCATTGAAG

Reverse complement sequence

CTTCAATGCCACAAATTTCTCGTTTTGACCTCGCCAACTCCCAAAAGGGGGCCGAATGCACGATTTTCGGCTAACACCCTGGTAGACAGTGCAGAAAGGG[A/C]
AAAACACAATTTACATAATAAGAATAGGCGAAAGAAAAGAAAGGTATGGCATAATGCGAAATGAGCAAAATAATAATACGCCAAAGACTTCGACCATCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 15.60% 14.50% 11.72% 58.15% NA
All Indica  2759 7.20% 3.80% 17.69% 71.37% NA
All Japonica  1512 30.40% 37.10% 1.26% 31.28% NA
Aus  269 12.30% 1.90% 11.90% 73.98% NA
Indica I  595 2.40% 6.60% 8.24% 82.86% NA
Indica II  465 5.80% 2.20% 21.29% 70.75% NA
Indica III  913 9.50% 1.00% 23.22% 66.27% NA
Indica Intermediate  786 8.90% 5.90% 16.28% 68.96% NA
Temperate Japonica  767 27.80% 61.70% 0.26% 10.30% NA
Tropical Japonica  504 30.60% 7.30% 2.98% 59.13% NA
Japonica Intermediate  241 38.20% 21.20% 0.83% 39.83% NA
VI/Aromatic  96 29.20% 3.10% 2.08% 65.62% NA
Intermediate  90 22.20% 14.40% 14.44% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402378307 T -> DEL N N silent_mutation Average:10.745; most accessible tissue: Callus, score: 20.498 N N N N
vg0402378307 T -> G LOC_Os04g04930.1 downstream_gene_variant ; 509.0bp to feature; MODIFIER silent_mutation Average:10.745; most accessible tissue: Callus, score: 20.498 N N N N
vg0402378307 T -> G LOC_Os04g04940.1 downstream_gene_variant ; 1158.0bp to feature; MODIFIER silent_mutation Average:10.745; most accessible tissue: Callus, score: 20.498 N N N N
vg0402378307 T -> G LOC_Os04g04930-LOC_Os04g04940 intergenic_region ; MODIFIER silent_mutation Average:10.745; most accessible tissue: Callus, score: 20.498 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402378307 NA 1.50E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 3.28E-08 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 4.37E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 1.10E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 1.70E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 6.14E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 7.81E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 4.97E-06 4.97E-06 mr1147_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 3.28E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 1.87E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 1.04E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 4.92E-09 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 9.09E-09 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 1.11E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 4.98E-07 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 1.23E-10 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 2.71E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 1.69E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 1.11E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 2.98E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 5.73E-07 mr1668_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 1.10E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 5.01E-06 mr1763_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 5.22E-09 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 3.99E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 3.01E-06 2.10E-10 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402378307 NA 2.45E-10 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251