\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402376506:

Variant ID: vg0402376506 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2376506
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.07, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGCCGCGAACGTGGCGATCGAAGACCGCGTCGACACCCCTGGCTACACTCCTACTCCAAGTCCAGGTCACAACGAGACCGGGGTGGAGTCAAACAGCT[T/C]
CCCCCTTCGACGAAAGGATTTGGAAGGGGCGAAGGCCCTAGTTGCGTTCTCGTCGGGCAAGGTGGCGAAGGGAGGTCCGGTCAAGAAGATCTCTAAAACT

Reverse complement sequence

AGTTTTAGAGATCTTCTTGACCGGACCTCCCTTCGCCACCTTGCCCGACGAGAACGCAACTAGGGCCTTCGCCCCTTCCAAATCCTTTCGTCGAAGGGGG[A/G]
AGCTGTTTGACTCCACCCCGGTCTCGTTGTGACCTGGACTTGGAGTAGGAGTGTAGCCAGGGGTGTCGACGCGGTCTTCGATCGCCACGTTCGCGGCCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 18.90% 14.30% 1.71% 65.09% NA
All Indica  2759 12.60% 3.40% 2.25% 81.70% NA
All Japonica  1512 31.00% 37.20% 1.12% 30.69% NA
Aus  269 9.30% 1.50% 0.37% 88.85% NA
Indica I  595 4.90% 5.50% 1.18% 88.40% NA
Indica II  465 1.90% 2.20% 0.86% 95.05% NA
Indica III  913 20.20% 0.90% 3.83% 75.14% NA
Indica Intermediate  786 16.20% 5.50% 2.04% 76.34% NA
Temperate Japonica  767 27.50% 62.10% 0.13% 10.30% NA
Tropical Japonica  504 32.10% 7.10% 1.59% 59.13% NA
Japonica Intermediate  241 39.40% 21.20% 3.32% 36.10% NA
VI/Aromatic  96 31.20% 1.00% 0.00% 67.71% NA
Intermediate  90 25.60% 13.30% 1.11% 60.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402376506 T -> C LOC_Os04g04930.1 missense_variant ; p.Phe378Ser; MODERATE nonsynonymous_codon ; F378S Average:9.766; most accessible tissue: Callus, score: 33.076 probably damaging -2.455 TOLERATED 1.00
vg0402376506 T -> DEL LOC_Os04g04930.1 N frameshift_variant Average:9.766; most accessible tissue: Callus, score: 33.076 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402376506 NA 1.94E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0402376506 NA 6.52E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 3.27E-08 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 2.78E-13 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 7.18E-07 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 8.96E-07 3.89E-12 mr1252 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 7.56E-08 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 9.48E-11 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 6.16E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 1.32E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 3.69E-13 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 2.83E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 8.85E-10 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 1.20E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 5.40E-06 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 4.57E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 8.22E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 3.52E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 4.42E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 5.48E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 1.65E-10 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 8.19E-09 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 6.52E-09 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 7.05E-07 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 3.53E-09 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 3.70E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 4.24E-07 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 6.49E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 1.56E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 3.40E-07 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 4.85E-08 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 5.48E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 9.36E-06 1.58E-11 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402376506 NA 6.78E-10 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251