\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402374019:

Variant ID: vg0402374019 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2374019
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCTTACCTAAGATCGCCAGAATCGCCACCGCCATGGCCGCCTCCGCCTCCTGCTCGTGCCCGCGCCGCCAACATCACCGCCGGCGCACCATGCCTCCGC[T/C]
GGCCACGAGATTAGGGTCGCCGCACCCTGGGGACCCCAAAACCGGCGCCATTCTGATGAAAACCGGCCTCCTCCTCCGCCGGCGTCGGCTCCTATGCAGA

Reverse complement sequence

TCTGCATAGGAGCCGACGCCGGCGGAGGAGGAGGCCGGTTTTCATCAGAATGGCGCCGGTTTTGGGGTCCCCAGGGTGCGGCGACCCTAATCTCGTGGCC[A/G]
GCGGAGGCATGGTGCGCCGGCGGTGATGTTGGCGGCGCGGGCACGAGCAGGAGGCGGAGGCGGCCATGGCGGTGGCGATTCTGGCGATCTTAGGTAAGGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.30% 16.50% 0.17% 0.00% NA
All Indica  2759 83.30% 16.60% 0.04% 0.00% NA
All Japonica  1512 84.00% 15.60% 0.40% 0.00% NA
Aus  269 88.80% 11.20% 0.00% 0.00% NA
Indica I  595 97.60% 2.40% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 66.80% 33.20% 0.00% 0.00% NA
Indica Intermediate  786 83.20% 16.70% 0.13% 0.00% NA
Temperate Japonica  767 97.30% 2.60% 0.13% 0.00% NA
Tropical Japonica  504 73.40% 26.00% 0.60% 0.00% NA
Japonica Intermediate  241 63.90% 35.30% 0.83% 0.00% NA
VI/Aromatic  96 53.10% 46.90% 0.00% 0.00% NA
Intermediate  90 86.70% 12.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402374019 T -> C LOC_Os04g04930.1 upstream_gene_variant ; 459.0bp to feature; MODIFIER silent_mutation Average:51.725; most accessible tissue: Zhenshan97 young leaf, score: 82.077 N N N N
vg0402374019 T -> C LOC_Os04g04914.1 downstream_gene_variant ; 1760.0bp to feature; MODIFIER silent_mutation Average:51.725; most accessible tissue: Zhenshan97 young leaf, score: 82.077 N N N N
vg0402374019 T -> C LOC_Os04g04914-LOC_Os04g04930 intergenic_region ; MODIFIER silent_mutation Average:51.725; most accessible tissue: Zhenshan97 young leaf, score: 82.077 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402374019 2.51E-08 NA mr1037 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402374019 7.79E-07 7.26E-11 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402374019 4.46E-10 NA mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402374019 1.77E-10 7.70E-18 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402374019 2.20E-08 NA mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402374019 3.11E-08 2.15E-10 mr1037_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402374019 NA 8.56E-06 mr1181_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402374019 6.81E-22 NA mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402374019 2.38E-19 1.08E-35 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402374019 1.19E-06 NA mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251