\
| Variant ID: vg0402374019 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2374019 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CCCTTACCTAAGATCGCCAGAATCGCCACCGCCATGGCCGCCTCCGCCTCCTGCTCGTGCCCGCGCCGCCAACATCACCGCCGGCGCACCATGCCTCCGC[T/C]
GGCCACGAGATTAGGGTCGCCGCACCCTGGGGACCCCAAAACCGGCGCCATTCTGATGAAAACCGGCCTCCTCCTCCGCCGGCGTCGGCTCCTATGCAGA
TCTGCATAGGAGCCGACGCCGGCGGAGGAGGAGGCCGGTTTTCATCAGAATGGCGCCGGTTTTGGGGTCCCCAGGGTGCGGCGACCCTAATCTCGTGGCC[A/G]
GCGGAGGCATGGTGCGCCGGCGGTGATGTTGGCGGCGCGGGCACGAGCAGGAGGCGGAGGCGGCCATGGCGGTGGCGATTCTGGCGATCTTAGGTAAGGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.30% | 16.50% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 83.30% | 16.60% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 84.00% | 15.60% | 0.40% | 0.00% | NA |
| Aus | 269 | 88.80% | 11.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 66.80% | 33.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 83.20% | 16.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 97.30% | 2.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 73.40% | 26.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 63.90% | 35.30% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 53.10% | 46.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 12.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402374019 | T -> C | LOC_Os04g04930.1 | upstream_gene_variant ; 459.0bp to feature; MODIFIER | silent_mutation | Average:51.725; most accessible tissue: Zhenshan97 young leaf, score: 82.077 | N | N | N | N |
| vg0402374019 | T -> C | LOC_Os04g04914.1 | downstream_gene_variant ; 1760.0bp to feature; MODIFIER | silent_mutation | Average:51.725; most accessible tissue: Zhenshan97 young leaf, score: 82.077 | N | N | N | N |
| vg0402374019 | T -> C | LOC_Os04g04914-LOC_Os04g04930 | intergenic_region ; MODIFIER | silent_mutation | Average:51.725; most accessible tissue: Zhenshan97 young leaf, score: 82.077 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402374019 | 2.51E-08 | NA | mr1037 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402374019 | 7.79E-07 | 7.26E-11 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402374019 | 4.46E-10 | NA | mr1798 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402374019 | 1.77E-10 | 7.70E-18 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402374019 | 2.20E-08 | NA | mr1037_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402374019 | 3.11E-08 | 2.15E-10 | mr1037_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402374019 | NA | 8.56E-06 | mr1181_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402374019 | 6.81E-22 | NA | mr1798_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402374019 | 2.38E-19 | 1.08E-35 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402374019 | 1.19E-06 | NA | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |