\
| Variant ID: vg0402373652 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2373652 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CTCTATCTTTCTGCTTCCCAGTTTCTCATGCCCCATTTCTCAGCCAGGCCGAGCCTTCACTGACTTAATCGCCACCACCACCGGAAAAATCCCCAAAACC[A/C]
TATTCCAGCGCTACTCACAGAGCTCTAAAATTCGTCGCACACATCGCCAATCGTCTGAAATTGAAGGTAAAAATAGATTCTCCATGCCAAGTAGTCCCTT
AAGGGACTACTTGGCATGGAGAATCTATTTTTACCTTCAATTTCAGACGATTGGCGATGTGTGCGACGAATTTTAGAGCTCTGTGAGTAGCGCTGGAATA[T/G]
GGTTTTGGGGATTTTTCCGGTGGTGGTGGCGATTAAGTCAGTGAAGGCTCGGCCTGGCTGAGAAATGGGGCATGAGAAACTGGGAAGCAGAAAGATAGAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.50% | 6.20% | 0.42% | 9.88% | NA |
| All Indica | 2759 | 83.50% | 6.90% | 0.29% | 9.39% | NA |
| All Japonica | 1512 | 84.40% | 3.50% | 0.46% | 11.64% | NA |
| Aus | 269 | 89.20% | 4.50% | 0.37% | 5.95% | NA |
| Indica I | 595 | 97.60% | 0.20% | 0.34% | 1.85% | NA |
| Indica II | 465 | 97.60% | 1.50% | 0.00% | 0.86% | NA |
| Indica III | 913 | 66.90% | 15.80% | 0.22% | 17.09% | NA |
| Indica Intermediate | 786 | 83.60% | 4.70% | 0.51% | 11.20% | NA |
| Temperate Japonica | 767 | 97.70% | 0.80% | 0.13% | 1.43% | NA |
| Tropical Japonica | 504 | 73.60% | 3.00% | 0.79% | 22.62% | NA |
| Japonica Intermediate | 241 | 64.70% | 13.30% | 0.83% | 21.16% | NA |
| VI/Aromatic | 96 | 50.00% | 36.50% | 2.08% | 11.46% | NA |
| Intermediate | 90 | 86.70% | 5.60% | 2.22% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402373652 | A -> C | LOC_Os04g04930.1 | upstream_gene_variant ; 826.0bp to feature; MODIFIER | silent_mutation | Average:42.036; most accessible tissue: Zhenshan97 young leaf, score: 65.804 | N | N | N | N |
| vg0402373652 | A -> C | LOC_Os04g04914.1 | downstream_gene_variant ; 1393.0bp to feature; MODIFIER | silent_mutation | Average:42.036; most accessible tissue: Zhenshan97 young leaf, score: 65.804 | N | N | N | N |
| vg0402373652 | A -> C | LOC_Os04g04914-LOC_Os04g04930 | intergenic_region ; MODIFIER | silent_mutation | Average:42.036; most accessible tissue: Zhenshan97 young leaf, score: 65.804 | N | N | N | N |
| vg0402373652 | A -> DEL | N | N | silent_mutation | Average:42.036; most accessible tissue: Zhenshan97 young leaf, score: 65.804 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402373652 | 3.81E-07 | NA | mr1037 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402373652 | 1.77E-07 | 1.32E-12 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402373652 | 1.95E-09 | NA | mr1798 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402373652 | 1.50E-09 | 4.54E-18 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402373652 | 1.33E-08 | NA | mr1037_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402373652 | 1.06E-09 | 6.60E-12 | mr1037_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402373652 | 1.45E-20 | NA | mr1798_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402373652 | 1.49E-21 | 2.72E-39 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402373652 | 6.34E-06 | NA | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |