\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402373652:

Variant ID: vg0402373652 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2373652
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTATCTTTCTGCTTCCCAGTTTCTCATGCCCCATTTCTCAGCCAGGCCGAGCCTTCACTGACTTAATCGCCACCACCACCGGAAAAATCCCCAAAACC[A/C]
TATTCCAGCGCTACTCACAGAGCTCTAAAATTCGTCGCACACATCGCCAATCGTCTGAAATTGAAGGTAAAAATAGATTCTCCATGCCAAGTAGTCCCTT

Reverse complement sequence

AAGGGACTACTTGGCATGGAGAATCTATTTTTACCTTCAATTTCAGACGATTGGCGATGTGTGCGACGAATTTTAGAGCTCTGTGAGTAGCGCTGGAATA[T/G]
GGTTTTGGGGATTTTTCCGGTGGTGGTGGCGATTAAGTCAGTGAAGGCTCGGCCTGGCTGAGAAATGGGGCATGAGAAACTGGGAAGCAGAAAGATAGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 6.20% 0.42% 9.88% NA
All Indica  2759 83.50% 6.90% 0.29% 9.39% NA
All Japonica  1512 84.40% 3.50% 0.46% 11.64% NA
Aus  269 89.20% 4.50% 0.37% 5.95% NA
Indica I  595 97.60% 0.20% 0.34% 1.85% NA
Indica II  465 97.60% 1.50% 0.00% 0.86% NA
Indica III  913 66.90% 15.80% 0.22% 17.09% NA
Indica Intermediate  786 83.60% 4.70% 0.51% 11.20% NA
Temperate Japonica  767 97.70% 0.80% 0.13% 1.43% NA
Tropical Japonica  504 73.60% 3.00% 0.79% 22.62% NA
Japonica Intermediate  241 64.70% 13.30% 0.83% 21.16% NA
VI/Aromatic  96 50.00% 36.50% 2.08% 11.46% NA
Intermediate  90 86.70% 5.60% 2.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402373652 A -> C LOC_Os04g04930.1 upstream_gene_variant ; 826.0bp to feature; MODIFIER silent_mutation Average:42.036; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0402373652 A -> C LOC_Os04g04914.1 downstream_gene_variant ; 1393.0bp to feature; MODIFIER silent_mutation Average:42.036; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0402373652 A -> C LOC_Os04g04914-LOC_Os04g04930 intergenic_region ; MODIFIER silent_mutation Average:42.036; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0402373652 A -> DEL N N silent_mutation Average:42.036; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402373652 3.81E-07 NA mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402373652 1.77E-07 1.32E-12 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402373652 1.95E-09 NA mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402373652 1.50E-09 4.54E-18 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402373652 1.33E-08 NA mr1037_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402373652 1.06E-09 6.60E-12 mr1037_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402373652 1.45E-20 NA mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402373652 1.49E-21 2.72E-39 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402373652 6.34E-06 NA mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251