Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0402346536:

Variant ID: vg0402346536 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2346536
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

TAGAAGTAAATGACAAGCATGGTATTCTCATGATGACAAACATGGTATCCTAGTAATGACAAGCTACTGTTGACGCATGACATGAAGTGGTAACCTGTAT[G/A]
AGGTTGACTCCGAAGATATGAATCATGAGAAGTTCTGGAACGGAAGCATCATTAAACTACCGCAACCTAGTCTGAGTCAGCAAAAAGGTGCACCCTGGTT

Reverse complement sequence

AACCAGGGTGCACCTTTTTGCTGACTCAGACTAGGTTGCGGTAGTTTAATGATGCTTCCGTTCCAGAACTTCTCATGATTCATATCTTCGGAGTCAACCT[C/T]
ATACAGGTTACCACTTCATGTCATGCGTCAACAGTAGCTTGTCATTACTAGGATACCATGTTTGTCATCATGAGAATACCATGCTTGTCATTTACTTCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.30%	0.50%	1.54%	10.62%	NA
All Indica	2759	99.70%	0.00%	0.25%	0.04%	NA
All Japonica	1512	64.70%	1.50%	4.03%	29.76%	NA
Aus	269	80.70%	0.00%	1.49%	17.84%	NA
Indica I	595	99.30%	0.00%	0.67%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.00%	0.38%	0.13%	NA
Temperate Japonica	767	75.50%	2.50%	3.78%	18.25%	NA
Tropical Japonica	504	56.20%	0.00%	4.56%	39.29%	NA
Japonica Intermediate	241	48.10%	1.70%	3.73%	46.47%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	0.00%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402346536	G -> DEL	N	N	silent_mutation	Average:37.143; most accessible tissue: Zhenshan97 flag leaf, score: 80.799	N	N	N	N
vg0402346536	G -> A	LOC_Os04g04880.1	upstream_gene_variant ; 2723.0bp to feature; MODIFIER	silent_mutation	Average:37.143; most accessible tissue: Zhenshan97 flag leaf, score: 80.799	N	N	N	N
vg0402346536	G -> A	LOC_Os04g04860.1	downstream_gene_variant ; 1992.0bp to feature; MODIFIER	silent_mutation	Average:37.143; most accessible tissue: Zhenshan97 flag leaf, score: 80.799	N	N	N	N
vg0402346536	G -> A	LOC_Os04g04870.1	downstream_gene_variant ; 984.0bp to feature; MODIFIER	silent_mutation	Average:37.143; most accessible tissue: Zhenshan97 flag leaf, score: 80.799	N	N	N	N
vg0402346536	G -> A	LOC_Os04g04860-LOC_Os04g04870	intergenic_region ; MODIFIER	silent_mutation	Average:37.143; most accessible tissue: Zhenshan97 flag leaf, score: 80.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402346536	5.91E-07	1.99E-08	mr1549	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402346536	1.06E-06	4.91E-10	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402346536	1.44E-07	1.14E-09	mr1549_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402346536	7.46E-06	3.92E-07	mr1550_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402346536	4.06E-08	2.40E-10	mr1757_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251