\
| Variant ID: vg0402346536 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 2346536 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 291. )
TAGAAGTAAATGACAAGCATGGTATTCTCATGATGACAAACATGGTATCCTAGTAATGACAAGCTACTGTTGACGCATGACATGAAGTGGTAACCTGTAT[G/A]
AGGTTGACTCCGAAGATATGAATCATGAGAAGTTCTGGAACGGAAGCATCATTAAACTACCGCAACCTAGTCTGAGTCAGCAAAAAGGTGCACCCTGGTT
AACCAGGGTGCACCTTTTTGCTGACTCAGACTAGGTTGCGGTAGTTTAATGATGCTTCCGTTCCAGAACTTCTCATGATTCATATCTTCGGAGTCAACCT[C/T]
ATACAGGTTACCACTTCATGTCATGCGTCAACAGTAGCTTGTCATTACTAGGATACCATGTTTGTCATCATGAGAATACCATGCTTGTCATTTACTTCTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.30% | 0.50% | 1.54% | 10.62% | NA |
| All Indica | 2759 | 99.70% | 0.00% | 0.25% | 0.04% | NA |
| All Japonica | 1512 | 64.70% | 1.50% | 4.03% | 29.76% | NA |
| Aus | 269 | 80.70% | 0.00% | 1.49% | 17.84% | NA |
| Indica I | 595 | 99.30% | 0.00% | 0.67% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.00% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 75.50% | 2.50% | 3.78% | 18.25% | NA |
| Tropical Japonica | 504 | 56.20% | 0.00% | 4.56% | 39.29% | NA |
| Japonica Intermediate | 241 | 48.10% | 1.70% | 3.73% | 46.47% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 0.00% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0402346536 | G -> DEL | N | N | silent_mutation | Average:37.143; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 | N | N | N | N |
| vg0402346536 | G -> A | LOC_Os04g04880.1 | upstream_gene_variant ; 2723.0bp to feature; MODIFIER | silent_mutation | Average:37.143; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 | N | N | N | N |
| vg0402346536 | G -> A | LOC_Os04g04860.1 | downstream_gene_variant ; 1992.0bp to feature; MODIFIER | silent_mutation | Average:37.143; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 | N | N | N | N |
| vg0402346536 | G -> A | LOC_Os04g04870.1 | downstream_gene_variant ; 984.0bp to feature; MODIFIER | silent_mutation | Average:37.143; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 | N | N | N | N |
| vg0402346536 | G -> A | LOC_Os04g04860-LOC_Os04g04870 | intergenic_region ; MODIFIER | silent_mutation | Average:37.143; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0402346536 | 5.91E-07 | 1.99E-08 | mr1549 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402346536 | 1.06E-06 | 4.91E-10 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402346536 | 1.44E-07 | 1.14E-09 | mr1549_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402346536 | 7.46E-06 | 3.92E-07 | mr1550_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0402346536 | 4.06E-08 | 2.40E-10 | mr1757_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |