\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0402346536:

Variant ID: vg0402346536 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 2346536
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


TAGAAGTAAATGACAAGCATGGTATTCTCATGATGACAAACATGGTATCCTAGTAATGACAAGCTACTGTTGACGCATGACATGAAGTGGTAACCTGTAT[G/A]
AGGTTGACTCCGAAGATATGAATCATGAGAAGTTCTGGAACGGAAGCATCATTAAACTACCGCAACCTAGTCTGAGTCAGCAAAAAGGTGCACCCTGGTT

Reverse complement sequence

AACCAGGGTGCACCTTTTTGCTGACTCAGACTAGGTTGCGGTAGTTTAATGATGCTTCCGTTCCAGAACTTCTCATGATTCATATCTTCGGAGTCAACCT[C/T]
ATACAGGTTACCACTTCATGTCATGCGTCAACAGTAGCTTGTCATTACTAGGATACCATGTTTGTCATCATGAGAATACCATGCTTGTCATTTACTTCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.30% 0.50% 1.54% 10.62% NA
All Indica  2759 99.70% 0.00% 0.25% 0.04% NA
All Japonica  1512 64.70% 1.50% 4.03% 29.76% NA
Aus  269 80.70% 0.00% 1.49% 17.84% NA
Indica I  595 99.30% 0.00% 0.67% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.00% 0.38% 0.13% NA
Temperate Japonica  767 75.50% 2.50% 3.78% 18.25% NA
Tropical Japonica  504 56.20% 0.00% 4.56% 39.29% NA
Japonica Intermediate  241 48.10% 1.70% 3.73% 46.47% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 0.00% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0402346536 G -> DEL N N silent_mutation Average:37.143; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 N N N N
vg0402346536 G -> A LOC_Os04g04880.1 upstream_gene_variant ; 2723.0bp to feature; MODIFIER silent_mutation Average:37.143; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 N N N N
vg0402346536 G -> A LOC_Os04g04860.1 downstream_gene_variant ; 1992.0bp to feature; MODIFIER silent_mutation Average:37.143; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 N N N N
vg0402346536 G -> A LOC_Os04g04870.1 downstream_gene_variant ; 984.0bp to feature; MODIFIER silent_mutation Average:37.143; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 N N N N
vg0402346536 G -> A LOC_Os04g04860-LOC_Os04g04870 intergenic_region ; MODIFIER silent_mutation Average:37.143; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0402346536 5.91E-07 1.99E-08 mr1549 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402346536 1.06E-06 4.91E-10 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402346536 1.44E-07 1.14E-09 mr1549_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402346536 7.46E-06 3.92E-07 mr1550_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402346536 4.06E-08 2.40E-10 mr1757_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251